How to ignore certain input lines in C++? - c++

Question

Okay so a little background this code is supposed to read through a file containing DNA and calculate the number of nucleotides A, C, T, G and print them out and also do some other slight calculations. My code runs fine for most files except for files that contain lines that start with # and + in the file. I need to skip those lines in order to get an accurate number. So my question is how to skip or ignore these lines in my calculations.
My code is
#include <iostream>
#include <stream>
#include <string>
#include <vector>
#include <map>
int main(int argc, char** argv) {
// Ignore how the above argc and argv are used here
auto arguments = std::vector<std::string>(argv, argv + argc);
// "arguments" box has what you wrote on the right side after &&
if (arguments.size() != 2) {
// ensure you wrote a file name after "./a.out"
std::cout << "Please give a file name as argument\n";
return 1;
}
auto file = std::fstream(arguments[1]);
if (!file) {
// ensure the file name you gave is from the available files
std::cout << "Cannot open " << arguments[1] << "\n";
return 1;
}
auto counts = std::map<char,int>({{'G',0.0},{'A',0.0},{'C',0.0},{'T',0.0}});
// Just a test loop to print all lines from the file
for (auto dna = std::string(); std::getline(file, dna); ) {
//std::cout << dna << "\n";
for (auto nucleotide:dna) {
counts[nucleotide]=counts[nucleotide] + 1;
}
}
double total = counts['A'] + counts['T'] + counts['G'] + counts['C'];
double GC = (counts['G'] + counts['C'])*100/total;
double AT = (counts['A'] + counts['T'])*100/total;
double ratio = AT/GC;
auto classification = "";
if ( 40.0 < GC < 60.0) {
classification = "moderate GC content";
}
if (60 <= GC) {
classification = "high GC content";
}
if (GC <= 40.0) {
classification = "low GC content";
}
std::cout << "GC-content: " << GC << "\n";
std::cout << "AT-content: " << AT << "\n";
std::cout << "G count: " << counts['G'] << "\n";
std::cout << "C count: " << counts['C'] << "\n";
std::cout << "A count: " << counts['A'] << "\n";
std::cout << "T count: " << counts['T'] << "\n";
std::cout << "Total count: " << total << "\n";
std::cout << "AT/GC Ratio: " << ratio << "\n";
std::cout << "GC Classification: " << classification << "\n";
}
The file that is giving me trouble is this which is like this
#ERR034677.1 HWI-EAS349_0046:7:1:2144:972#0 length=76
NGATGATAAACAAGAGGGTAAAAAGAAAAAAGCTACAGACATTTCTGCTAATCTATTATTTTGTTCCTTTTTTTTT
+ERR034677.1 HWI-EAS349_0046:7:1:2144:972#0 length=76
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
If anyone can help me with this. I will be very grateful. I only need a hint or an idea of the concept I am missing so I can make my code compatible with all files. Thanks in advance

Answer 1

Your actual problem seems to be the standard case of "input is not always clean syntax".
The solution is always "do not expect clean syntax".
First read whole lines into a buffer.
Then check for syntax.
Skip broken syntax.
Scan clean syntax from buffer.