I have a large pipe-delimited text file that should have one 3-column record per line. Many of the records are split up by line breaks within a column.
I need to do a find/replace to get three, and only three, pipes per line/record.
Here's an example (I added the line breaks (\r\n) to demonstrate where they are and what needs to be replaced):
12-1234|The quick brown fox jumped over the lazy dog.|Every line should look similar to this one|\r\n
56-7890A|This record is split\r\n
\r\n
on to multiple lines|More text|\r\n
09-1234AS|\r\n
||\r\n
\r\n
56-1234|Some text|Some more text\r\n
|\r\n
76-5432ABC|A record will always start with two digits, a dash and four digits|There may or may not be up to three letters after the four digits|\r\n
The caveat is that I need to retain those mid-record line breaks for the target system. They need to be replaced with \.br\. So the final result of the above should look like this:
12-1234|The quick brown fox jumped over the lazy dog.|Every line should look similar to this one|\r\n
56-7890A|This record is split\.br\\.br\on multiple lines|More text|\r\n
09-1234AS|\.br\||\.br\\r\n
56-1234|Some text|Some more text\.br\|\r\n
76-5432ABC|A record will always start with two digits, a dash and four digits|There may or may not be up to three letters after the four digits|\r\n
As you can see the mid-record line breaks have all been replaced with \.br\ and the end-of-line line breaks have been retained to keep each three-column/pipe record on its own line. Note the last record's text, explaining how each line/record begins. I included that in case that would help in building a regex to properly identify the beginning of a record.
I'm not sure if this can be done in one find/replace step or if it needs to be (or just should be) split up into a couple of steps.
I had the thought to first search for |\r\n, since all records end with a pipe and a CRLF, and replace those with dummy text !##$. Then search for the remaining line breaks with \r\n, which will be mid-column line breaks and replace those with \.br\, then replace the dummy text with the original line breaks that I want to keep |\r\n.
That worked for all but records that looked like the third record in the first example, which has several line breaks after a pipe within the record. In such a large file as I am working with it wasn't until much later that I found that the above process I was using didn't properly catch those instances.
You can use
(?:\G(?!^(?<!.))|^\d{2}-\d+[A-Z]*\|[^|]*?(?:\|[^|]*?)?)\K\R+
Replace with \\.br\\. See the regex demo. Details:
(?:\G(?!^(?<!.))|^\d{2}-\d+[A-Z]*\|[^|]*?(?:\|[^|]*?)?) - either the end of the previous match (\G(?!^(?<!.))) or (|) start of a line, two digits, 0, one or more digits, zero or more letters, a |, then any zero or more chars other than |, as few as possible, and then an optional sequence of | and any zero or more chars other than |, as few as possible (see ^\d{2}-\d+[A-Z]*\|[^|]*?(?:\|[^|]*?)?)
\K - omit the text matched
\R+ - one or more line breaks.
See the Notepad++ demo:
If you need to remove empty lines after this, use Edit > Line Operations > Remove Empty Lines.
I have a file with 250 fasta sequences. Right now, the they look like this:
>NP_041982.1 DNA polymerase [Enterobacteria phage T7]
I want to change the headers so they look like this:
>Enterobacteria phage T7
For each header, I only want what is in-between the brackets. I'm trying to do this through linux commands.
Can anyone help with this?
file.fa contents
>Sequence One [Species 1]
actgtattagctaatcgatcagttacgattcga
tagctacgtacgtacgatcgatcagtcagctag
>Sequence Two [Species 2]
ttgtagctagctagctagctagctagctacgta
tgcatcgatcgattaatatcgcgccctaactcg
>Sequence Three
atgatagtctggtcatcgattcagtcagttcat
ttgcatgatctactagatcgatattagctagat
>Sequence Four [early bracket] text
tagctacgtacgatcgtacgatcgatcgtatat
gctagtcgactagctagctacgtacgtacgtaa
sed command:
sed 's#^>[^\[]*\[\([^\]*\)]$#>\1#g' file.fa
It looks a bit convoluted, but it means...
take any string of characters that matches the pattern of "a line that starts with >, followed by any number of characters besides [, followed by any number of characters besides ], followed by ]. Capture the string between the brackets, and replace the entire match with just the thing in the brackets.
prints the output
>Species 1
actgtattagctaatcgatcagttacgattcga
tagctacgtacgtacgatcgatcagtcagctag
>Species 2
ttgtagctagctagctagctagctagctacgta
tgcatcgatcgattaatatcgcgccctaactcg
>Sequence Three
atgatagtctggtcatcgattcagtcagttcat
ttgcatgatctactagatcgatattagctagat
>Sequence Four [early bracket] text
tagctacgtacgatcgtacgatcgatcgtatat
gctagtcgactagctagctacgtacgtacgtaa
the output can be saved to a new file with
sed 's#^>[^\[]*\[\([^\]*\)]$#>\1#g' file.fa > converted_filename.fa
Note that any headers without matches are printed as-is, and any lines that have characters after the final bracket will also be printed as-is. Might act odd if it encounters left brackets that are not closed on the same line. I'd recommend you double check that the new file has the same number of lines as the original.
A while back, I asked a question about merging lines which have a common first field. Here's the original: Command line to match lines with matching first field (sed, awk, etc.)
Sample input:
a|lorem
b|ipsum
b|dolor
c|sit
d|amet
d|consectetur
e|adipisicing
e|elit
Desired output:
b|ipsum|dolor
d|amet|consectetur
e|adipisicing|elit
The idea is that if the first field matches, then the lines are merged. The input is sorted. The actual content is more complex, but uses the pipe as the sole delimiter.
The methods provided in the prior question worked well on my 0.5GB file, processing in ~16 seconds. However, my new file is approx 100x larger, and I prefer a method that streams. In theory, this will be able to run in ~30 minutes. The prior method failed to complete after running 24 hours.
Running on MacOS (i.e., BSD-type unix).
Ideas? [Note, the prior answer to the prior question was NOT a one-liner.]
You can append you results to a file on the fly so that you don't need to build a 50GB array (which I assume you don't have the memory for!). This command will concatenate the join fields for each of the different indices in a string which is written to a file named after the respective index with some suffix.
EDIT: on the basis of OP's comment that content may have spaces, I would suggest using -F"|" instead of sub and also the following answer is designed to write to standard out
(New) Code:
# split the file on the pipe using -F
# if index "i" is still $1 (and i exists) concatenate the string
# if index "i" is not $1 or doesn't exist yet, print current a
# (will be a single blank line for first line)
# afterwards, this will print the concatenated data for the last index
# reset a for the new index and take the first data set
# set i to $1 each time
# END statement to print the single last string "a"
awk -F"|" '$1==i{a=a"|"$2}$1!=i{print a; a=$2}{i=$1}END{print a}'
This builds a string of "data" while in a given index and then prints it out when index changes and starts building the next string on the new index until that one ends... repeat...
sed '# label anchor for a jump
:loop
# load a new line in working buffer (so always 2 lines loaded after)
N
# verify if the 2 lines have same starting pattern and join if the case
/^\(\([^|]\)*\(|.*\)\)\n\2/ s//\1/
# if end of file quit (and print result)
$ b
# if lines are joined, cycle and re make with next line (jump to :loop)
t loop
# (No joined lines here)
# if more than 2 element on first line, print first line
/.*|.*|.*\n/ P
# remove first line (using last search pattern)
s///
# (if anay modif) cycle (jump to :loop)
t loop
# exit and print working buffer
' YourFile
posix version (maybe --posix on Mac)
self commented
assume sorted entry, no empty line, no pipe in data (nor escaped one)
used unbufferd -u for a stream process if available
A several line document has a header/title section and then about 10 listings under each. I need to put the header/title info in with each of the listings so that they can be properly uploaded into a website (using comma and pipe delimiters). It looks like this:
SectionName1 and TitleName1
1111 - The SubSectionName A
222 - The SubSectionName B
3333 - The SubSectionName C
SectionName2 and TitleName2
444 - The SubSectionName D
55555 - The SubSectionName E
66 - The SubSectionName F
Repeating several hundred times. What I need is to produce something like:
SectionName1,TitleName1,1111,SubSectionNameA
SectionName1,TitleName1,222,SubSectionNameB
SectionName1,TitleName1,3333,SubSectionNameC
SectionName2,TitleName2,444,SubSectionNameD
SectionName2,TitleName2,55555,SubSectionNameE
SectionName2,TitleName2,66,SubSectionNameF
I realize there can multiple approaches to this solution, but I'm having a difficult time pulling the trigger on any one method. I understand submatches, joins and getline but I am not good at practical use of them in this scenario.
Any help to get me mentally started would be greatly appreciated.
Let me propose the following quite general Ex command solving the
issue.1
:g/^\s*\h/d|let#"=substitute(#"[:-2],'\s\+and\s\+',',','')|ki|/\n\s*\h\|\%$/kj|
\ 'i,'js/^\s*\(\d\+\)\s\+-\s\+The/\=#".','.submatch(1).','/|'i,'js/\s\+//g
At the top level, this is the :global command that enumerates the lines
starting with zero or more whitespace characters followed by a Latin letter or
an underscore (see :help /\h). The lines matching this pattern are supposed
to be the header lines containing section and title names. The rest of the
command, after the pattern describing the header lines, are instructions to be
executed for each of those lines.
The actions to be performed on the headers can be divided into three steps.
Delete the current header line, at the same time extracting section
and title names from it.
:d|let#"=substitute(#"[:-2],'\s\+and\s\+',',','')
First, remove the current line, saving it into the unnamed register,
using the :delete command. Then, update the contents of that
register (referred to as #"; see :help #r and :help "") to be
result of the substitution changing the word and surrounded by
whitespace characters, to a single comma. The actual replacement is
carried out by the substitute() function.
However, the input is not the exact string containing the whole header
line, but its prefix leaving out the last character, which is
a newline symbol. The [:-2] notation is a short form of the
[0:-2] subscript expression that designates the substring from the
very first byte to the second one counting from the end (see :help
expr-[:]). This way, the unnamed register holds the section and the
title names separated by comma.
Determine the range of dependent subsection lines.
:ki|/\n\s*\h\|\%$/kj
After the first step, the subsection records belonging to the just
parsed header line are located starting from the current line (the one
followed the header) until the next header line or, if there is no
such line below, the end of buffer. The numbers of these lines are
stored in the marks i and j, respectively. (See :helpg ^A mark
is for description of marks.)
The marks are placed using the :k command that sets a specified mark
at the last line of a given range which is the current line, by
default. So, unlike the first line of the considered block, the last
one requires a specific line range to point out its location.
A particular form of range, denoting the next line where a given
pattern matches, is used in this case (see :help :range). The
pattern defining the location of the line to be found, is composed in
such a way that it matches a line immediately preceding a header (a
line starting with possible whitespace followed by an alphabetical
character), or the very last line. (See :help pattern for details
about syntax of Vim regular expressions.)
Transform the delineated subsection lines according to desired format,
prepending section and title names found in the corresponding header
line.
:'i,'js/^\s*\(\d\+\)\s\+-\s\+The/\=#".','.submatch(1).','/|'i,'js/\s\+//g
This step comprised of the two :substitute commands that are run
over the range of lines delimited by the locations labelled by the
marks i and j (see :help [range]).
The first substitution command matches the beginning of a subsection
line—an identifier followed by a hyphen and the word The, all
floating in a whitespace—and replaces it with the contents of the
unnamed register, holding the section and title names concatenated
with a comma, the matched identifier, and another comma. The second
substitution finalizes the transformation by squeezing all whitespace
characters on the line to gum the subsection name and the following
letter together.
To construct the replacement string in the first :substitute
command, the substitute-with-an-expression feature is used (see :help
sub-replace-\=). The substitution part of the command should start
with \= for Vim to interpret the remaining text not in a regular
way, but as an expression (see :help expression). The result of
that expression's evaluation becomes the substitution string. Note
the use of the submatch() function in the substitute expression to
retrieve the text of a submatch by its number.
1 The command is wrapped for better readability, its one-line
version is listed below for ease of copy-pasting into Vim command line. Note
that the wrapped command can be used in a Vim script without any change.
:g/^\s*\h/d|let#"=substitute(#"[:-2],'\s\+and\s\+',',','')|ki|/\n\s*\h\|\%$/kj|'i,'js/^\s*\(\d\+\)\s\+-\s\+The/\=#".','.submatch(1).','/|'i,'js/\s\+//g
Simplest/fastest way I can think of is a simple macro. Do once, rinse, repeat.
Assuming your cursor is initially on the first character of the first line (S of SectionName), this macro should work as long as the document is exactly in the same format as posted above.
f ctT,<Esc>yyjpjjpjddkkkddkkkJr,f ctS,<Esc>f xjJr,f ctS,f xjJr,f ctS,<Esc>f xjdd
well I think the question is not that clear. why in your demo input, after "-", the text was like:
55555 - The SubSectionName E
but in your expected output, it turned into:
55555,SubSectionNameE
all spaces were removed, this is ok, but why "The" was removed as well? is there any pattern for "the" ?
I wrote an awk oneliner, it removes all spaces in output, but leave those "The" there, you can change it to get the right output you need.
awk -F' and ' -vOFS="," 'NF>1{s=$1;t=$2;next;}$1{gsub(/\s+/,"");gsub(/-/,",");print s,t,$0} ' input
test on your example input:
kent$ cat v
SectionName1 and TitleName1
1111 - The SubSectionName A
222 - The SubSectionName B
3333 - The SubSectionName C
SectionName2 and TitleName2
444 - The SubSectionName D
55555 - The SubSectionName E
66 - The SubSectionName F
kent$ awk -F' and ' -vOFS="," 'NF>1{s=$1;t=$2;next;}$1{gsub(/\s+/,"");gsub(/-/,",");print s,t,$0} ' v
SectionName1,TitleName1,1111,TheSubSectionNameA
SectionName1,TitleName1,222,TheSubSectionNameB
SectionName1,TitleName1,3333,TheSubSectionNameC
SectionName2,TitleName2,444,TheSubSectionNameD
SectionName2,TitleName2,55555,TheSubSectionNameE
SectionName2,TitleName2,66,TheSubSectionNameF
I'm stuck with this for several hours now and cycled through a wealth of different tools to get the job done. Without success. It would be fantastic, if someone could help me out with this.
Here is the problem:
I have a very large CSV file (400mb+) that is not formatted correctly. Right now it looks something like this:
This is a long abstract describing something. What follows is the tile for this sentence."
,Title1
This is another sentence that is running on one line. On the next line you can find the title.
,Title2
As you can probably see the titles ",Title1" and ",Title2" should actually be on the same line as the foregoing sentence. Then it would look something like this:
This is a long abstract describing something. What follows is the tile for this sentence.",Title1
This is another sentence that is running on one line. On the next line you can find the title.,Title2
Please note that the end of the sentence can contain quotes or not. In the end they should be replaced too.
Here is what I came up with so far:
sed -n '1h;1!H;${;g;s/\."?.*,//g;p;}' out.csv > out1.csv
This should actually get the job done of matching the expression over multiple lines. Unfortunately it doesn't :)
The expression is looking for the dot at the end of the sentence and the optional quotes plus a newline character that I'm trying to match with .*.
Help much appreciated. And it doesn't really matter what tool gets the job done (awk, perl, sed, tr, etc.).
Multiline in sed isn't necessarily tricky per se, it's just that it uses commands most people aren't familiar with and have certain side effects, like delimiting the current line from the next line with a '\n' when you use 'N' to append the next line to the pattern space.
Anyway, it's much easier if you match on a line that starts with a comma to decide whether or not to remove the newline, so that's what I did here:
sed 'N;/\n,/s/"\? *\n//;P;D' title_csv
Input
$ cat title_csv
don't touch this line
don't touch this line either
This is a long abstract describing something. What follows is the tile for this sentence."
,Title1
seriously, don't touch this line
This is another sentence that is running on one line. On the next line you can find the title.
,Title2
also, don't touch this line
Output
$ sed 'N;/\n,/s/"\? *\n//;P;D' title_csv
don't touch this line
don't touch this line either
This is a long abstract describing something. What follows is the tile for this sentence.,Title1
seriously, don't touch this line
This is another sentence that is running on one line. On the next line you can find the title.,Title2
also, don't touch this line
Yours works with a couple of small changes:
sed -n '1h;1!H;${;g;s/\."\?\n,//g;p;}' inputfile
The ? needs to be escaped and . doesn't match newlines.
Here's another way to do it which doesn't require using the hold space:
sed -n '${p;q};N;/\n,/{s/"\?\n//p;b};P;D' inputfile
Here is a commented version:
sed -n '
$ # for the last input line
{
p; # print
q # and quit
};
N; # otherwise, append the next line
/\n,/ # if it starts with a comma
{
s/"\?\n//p; # delete an optional comma and the newline and print the result
b # branch to the end to read the next line
};
P; # it doesn't start with a comma so print it
D # delete the first line of the pair (it's just been printed) and loop to the top
' inputfile