Finding strings across lines and replace with nothing - regex

I have some 'fastq' format DNA sequence files (basically just text files) like this:
#Sample_1
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
#
+
#
+
#Sample_4
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
My ultimate goal is to turn these into 'fasta' format files, but to do that I need to get rid of the two empty sequences in the middle.
EDIT
The desired output would look like this:
#Sample_1
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
#Sample_4
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
All of the dedicated software I tried (Biopython, stand alone programs, perl scripts posted by others) crash at the empty sequences. This is really just a problem of searching for the string #\n+ and replacing it with nothing. I googled this and read several posts and tried about a million options with sed and couldn't figure it out. Here are some things that didn't work:
sed s/'#'/,/'+'// test.fastq > test.fasta
sed s/'#,+'// test.fastq > test.fasta
Any insights would be greatly appreciated.
PS. I've got a Mac.

Try:
sed "/^[#+]*$/d" test.fastq > test.fasta
The /d option tells sed to "delete" the matching line (i.e. not print it).
^ and $ mean "start of string" and "end of string" respectively, i.e. the line must be an exact match.
So, the above command basically says:
Print all lines that do not only contain # or +, and write the result to test.fasta.
Edit: I misunderstood the question slightly, sorry. If you want to only remove pairs of consecutive lines like
#
+
then you need to perform a multi-line search and replace.
Although this can be done with sed, it's perhaps easier to use something like a perl script instead:
perl -0pe 's/^#\n\+\n//gm' test.fastq > test.fasta
The -0 option turns Perl into "file slurp" mode, where Perl reads the entire input file in one shot (instead of line by line). This enables multi-line search and replace.
The -pe option allows you to run Perl code (pattern matching and replacement in this case) and display output from the command line.
^#\n\+\n is the pattern to match, which we are replacing with nothing (i.e. deleting).
/gm makes the substitution multiline and global.
You could also instead pass -i as the first parameter to perl, to edit the file inline.

This may not be the most elegant solution in the world, but you can use tr to replace the \n with a null character and back.
cat test.fastq | tr '\n' '\0' | sed 's/#\x0+\x0//g' | tr '\0' '\n' > test.fasta

Try this:
sed '/^#$/{N;/\n+$/d}' file
When # is found, next line is appended to the pattern space with N.
If $ is found in next line, the d command deletes both lines.

Related

Modifying a pattern-matched line as well as next line in a file

I'm trying to write a script that, among other things, automatically enable multilib. Meaning in my /etc/pacman.conf file, I have to turn this
#[multilib]
#Include = /etc/pacman.d/mirrorlist
into this
[multilib]
Include = /etc/pacman.d/mirrorlist
without accidentally removing # from lines like these
#[community-testing]
#Include = /etc/pacman.d/mirrorlist
I already accomplished this by using this code
linenum=$(rg -n '\[multilib\]' /etc/pacman.conf | cut -f1 -d:)
sed -i "$((linenum))s/#//" /etc/pacman.conf
sed -i "$((linenum+1))s/#//" /etc/pacman.conf
but I'm wondering, whether this can be solved in a single line of code without any math expressions.
With GNU sed. Find row starting with #[multilib], append next line (N) to pattern space and then remove all # from pattern space (s/#//g).
sed -i '/^#\[multilib\]/{N;s/#//g}' /etc/pacman.conf
If the two lines contain further #, then these are also removed.
Could you please try following, written with shown samples only. Considering that multilib and it's very next line only you want to deal with.
awk '
/multilib/ || found{
found=$0~/multilib/?1:""
sub(/^#+/,"")
print
}
' Input_file
Explanation:
First checking if a line contains multilib or variable found is SET then following instructions inside it's block.
Inside block checking if line has multilib then set it to 1 or nullify it. So that only next line after multilib gets processed only.
Using sub function of awk to substitute starting hash one or more occurences with NULL here.
Then printing current line.
This will work using any awk in any shell on every UNIX box:
$ awk '$0 == "#[multilib]"{c=2} c&&c--{sub(/^#/,"")} 1' file
[multilib]
Include = /etc/pacman.d/mirrorlist
and if you had to uncomment 500 lines instead of 2 lines then you'd just change c=2 to c=500 (as opposed to typing N 500 times as with the currently accepted solution). Note that you also don't have to escape any characters in the string you're matching on. So in addition to being robust and portable this is a much more generally useful idiom to remember than the other solutions you have so far. See printing-with-sed-or-awk-a-line-following-a-matching-pattern/17914105#17914105 for more.
A perl one-liner:
perl -0777 -api.back -e 's/#(\[multilib]\R)#/$1/' /etc/pacman.conf
modify in place with a backup of original in /etc/pacman.conf.back
If there is only one [multilib] entry, with ed and the shell's printf
printf '/^#\[multilib\]$/;+1s/^#//\n,p\nQ\n' | ed -s /etc/pacman.conf
Change Q to w to edit pacman.conf
Match #[multilib]
; include the next address
+1 the next line (plus one line below)
s/^#// remove the leading #
,p prints everything to stdout
Q exit/quit ed without error message.
-s means do not print any message.
Ed can do this.
cat >> edjoin.txt << EOF
/multilib/;+j
s/#//
s/#/\
/
wq
EOF
ed -s pacman.conf < edjoin.txt
rm -v ./edjoin.txt
This will only work on the first match. If you have more matches, repeat as necessary.
This might work for you (GNU sed):
sed '/^#\[multilib\]/,+1 s/^#//' file
Focus on a range of lines (in this case, two) where the first line begins #[multilib] and remove the first character in those lines if it is a #.
N.B. The [ and ] must be escaped in the regexp otherwise they will match a single character that is m,u,l,t,i or b. The range can be extended by changing the integer +1 to +n if you were to want to uncomment n lines plus the matching line.
To remove all comments in a [multilib] section, perhaps:
sed '/^#\?\[[^]]*\]$/h;G;/^#\[multilib\]/M s/^#//;P;d' file

Print commands in history consisting in just one word

I want to print lines that contains single word only.
For example:
this is a line
another line
one
more
line
last one
I want to get the ones with single word only
one
more
line
EDIT: Guys, thank you for answers. Almost all of the answers work for my test file. However I wanted to list single lines in bash history. When I try your answers like
history | your posted commands
all of them below fails. Some only prints some numbers (might line numbers?)
You want to get all those commands in history that contain just one word. Considering that history prints the number of the command as a first column, you need to match those lines consisting in two words.
For this, you can say:
history | awk 'NF==2'
If you just want to print the command itself, say:
history | awk 'NF==2 {print $2}'
To rehash your problem, any line containing a space or nothing should be removed.
grep -Ev '^$| ' file
Your problem statement is unspecific on whether lines containing only punctuation might also occur. Maybe try
grep -Ex '[A-Za-z]+' file
to only match lines containing only one or more alphabetics. (The -x option implicitly anchors the pattern -- it requires the entire line to match.)
In Bash, the output from history is decorated with line numbers; maybe try
history | grep -E '^ *[0-9]+ [A-Za-z]+$'
to match lines where the line number is followed by a single alphanumeric token. Notice that there will be two spaces between the line number and the command.
In all cases above, the -E selects extended regular expression matching, aka egrep (basic RE aka traditional grep does not support e.g. the + operator, though it's available as \+).
Try this:
grep -E '^\s*\S+\s*$' file
With the above input, it will output:
one
more
line
If your test strings are in a file called in.txt, you can try the following:
grep -E "^\w+$" in.txt
What it means is:
^ starting the line with
\w any word character [a-zA-Z0-9]
+ there should be at least 1 of those characters or more
$ line end
And output would be
one
more
line
Assuming your file as texts.txt and if grep is not the only criteria; then
awk '{ if ( NF == 1 ) print }' texts.txt
If your single worded lines don't have a space at the end you can also search for lines without an empty space :
grep -v " "
I think that what you're looking for could be best described as a newline followed by a word with a negative lookahead for a space,
/\n\w+\b(?! )/g
example

Regular Expression to parse Common Name from Distinguished Name

I am attempting to parse (with sed) just First Last from the following DN(s) returned by the DSCL command in OSX terminal bash environment...
CN=First Last,OU=PCS,OU=guests,DC=domain,DC=edu
I have tried multiple regexs from this site and others with questions very close to what I wanted... mainly this question... I have tried following the advice to the best of my ability (I don't necessarily consider myself a newbie...but definitely a newbie to regex..)
DSCL returns a list of DNs, and I would like to only have First Last printed to a text file. I have attempted using sed, but I can't seem to get the correct function. I am open to other commands to parse the output. Every line begins with CN= and then there is a comma between Last and OU=.
Thank you very much for your help!
I think all of the regular expression answers provided so far are buggy, insofar as they do not properly handle quoted ',' characters in the common name. For example, consider a distinguishedName like:
CN=Doe\, John,CN=Users,DC=example,DC=local
Better to use a real library able to parse the components of a distinguishedName. If you're looking for something quick on the command line, try piping your DN to a command like this:
echo "CN=Doe\, John,CN=Users,DC=activedir,DC=local" | python -c 'import ldap; import sys; print ldap.dn.explode_dn(sys.stdin.read().strip(), notypes=1)[0]'
(depends on having the python-ldap library installed). You could cook up something similar with PHP's built-in ldap_explode_dn() function.
Two cut commands is probably the simplest (although not necessarily the best):
DSCL | cut -d, -f1 | cut -d= -f2
First, split the output from DSCL on commas and print the first field ("CN=First Last"); then split that on equal signs and print the second field.
Using sed:
sed 's/^CN=\([^,]*\).*/\1/' input_file
^ matches start of line
CN= literal string match
\([^,]*\) everything until a comma
.* rest
http://www.gnu.org/software/gawk/manual/gawk.html#Field-Separators
awk -v RS=',' -v FS='=' '$1=="CN"{print $2}' foo.txt
I like awk too, so I print the substring from the fourth char:
DSCL | awk '{FS=","}; {print substr($1,4)}' > filterednames.txt
This regex will parse a distinguished name, giving name and val a capture groups for each match.
When DN strings contain commas, they are meant to be quoted - this regex correctly handles both quoted and unquotes strings, and also handles escaped quotes in quoted strings:
(?:^|,\s?)(?:(?<name>[A-Z]+)=(?<val>"(?:[^"]|"")+"|[^,]+))+
Here is is nicely formatted:
(?:^|,\s?)
(?:
(?<name>[A-Z]+)=
(?<val>"(?:[^"]|"")+"|[^,]+)
)+
Here's a link so you can see it in action:
https://regex101.com/r/zfZX3f/2
If you want a regex to get only the CN, then this adapted version will do it:
(?:^|,\s?)(?:CN=(?<val>"(?:[^"]|"")+"|[^,]+))

using sed to copy lines and delete characters from the duplicates

I have a file that looks like this:
#"Afghanistan.png",
#"Albania.png",
#"Algeria.png",
#"American_Samoa.png",
I want it to look like this
#"Afghanistan.png",
#"Afghanistan",
#"Albania.png",
#"Albania",
#"Algeria.png",
#"Algeria",
#"American_Samoa.png",
#"American_Samoa",
I thought I could use sed to do this but I can't figure out how to store something in a buffer and then modify it.
Am I even using the right tool?
Thanks
You don't have to get tricky with regular expressions and replacement strings: use sed's p command to print the line intact, then modify the line and let it print implicitly
sed 'p; s/\.png//'
Glenn jackman's response is OK, but it also doubles the rows which do not match the expression.
This one, instead, doubles only the rows which matched the expression:
sed -n 'p; s/\.png//p'
Here, -n stands for "print nothing unless explicitely printed", and the p in s/\.png//p forces the print if substitution was done, but does not force it otherwise
That is pretty easy to do with sed and you not even need to use the hold space (the sed auxiliary buffer). Given the input file below:
$ cat input
#"Afghanistan.png",
#"Albania.png",
#"Algeria.png",
#"American_Samoa.png",
you should use this command:
sed 's/#"\([^.]*\)\.png",/&\
#"\1",/' input
The result:
$ sed 's/#"\([^.]*\)\.png",/&\
#"\1",/' input
#"Afghanistan.png",
#"Afghanistan",
#"Albania.png",
#"Albania",
#"Algeria.png",
#"Algeria",
#"American_Samoa.png",
#"American_Samoa",
This commands is just a replacement command (s///). It matches anything starting with #" followed by non-period chars ([^.]*) and then by .png",. Also, it matches all non-period chars before .png", using the group brackets \( and \), so we can get what was matched by this group. So, this is the to-be-replaced regular expression:
#"\([^.]*\)\.png",
So follows the replacement part of the command. The & command just inserts everything that was matched by #"\([^.]*\)\.png", in the changed content. If it was the only element of the replacement part, nothing would be changed in the output. However, following the & there is a newline character - represented by the backslash \ followed by an actual newline - and in the new line we add the #" string followed by the content of the first group (\1) and then the string ",.
This is just a brief explanation of the command. Hope this helps. Also, note that you can use the \n string to represent newlines in some versions of sed (such as GNU sed). It would render a more concise and readable command:
sed 's/#"\([^.]*\)\.png",/&\n#"\1",/' input
I prefer this over Carles Sala and Glenn Jackman's:
sed '/.png/p;s/.png//'
Could just say it's personal preference.
or one can combine both versions and apply the duplication only on lines matching the required pattern
sed -e '/^#".*\.png",/{p;s/\.png//;}' input

Regular expression to find a line containing certain characters and remove that line

I have text file which has lot of character entries one line after another.
I want to find all lines which start with :: and delete all those lines.
What is the regular expression to do this?
-AD
Regular expressions don't "do" anything. They only match text.
What you want is some tools that uses regular expressions to identify a line and then apply some command to those tools.
One such tools is sed (there's also awk and many others). You'd use it like this:
sed -e "/^::/d" < input.txt > output.txt
The part "/^::/" tells sed to apply the following command to all lines that start with "::" and "d" simply means "delete that line".
Or the simplest solution (which my brain didn't produce for some strange reason):
grep -v "^::" input.txt > output.txt
sed -i -e '/^::/d' yourfile.txt
^::.*[\r\n]*
If you're reading the file line-by-line you won't need the [\r\n]* part.
Simple as:
^::
If you don't have sed or grep, find this and replace with empty string:
^::.*[\r\n]
Thanks for the pointers:
Following thing worked for me. After "::" any character was possiblly present in the text file so i gave:
^::[a-zA-Z0-9 I put all punctuation symbols here]*$
-AD
Here's my contribution in C#:
Text stream:
string stream = :: This is a comment line
Syntax:
Regex commentsExp = new Regex("^::.*", RegexOptions.Singleline);
Usage:
Console.WriteLine(commentsExp.Replace(stream, string.Empty));
Alternatively, if I wanted to simply take a text file that included comments and produce an exact duplicate without the comment lines I could use a simple but effective combination of the type and findstr commandline tools:
type commented.txt | findstr /v /R "^::" > uncommented.txt