Split string on special character - regex

Question

I have a string (fasta format), something like this:
a = ">atttaggacctta\nattgtcggta\n>ccattnnnn\ncccatt\n>ttaggccta"
and would like to seperate at character >, filter out the newlines and put the thre substrings seperated by > into a vector or list with three elements:
>atttaggaccttaattgtcggta
>ccattnnnncccatt
>ttaggccta
I tried strsplit:
unlist(strsplit(a, "(?<=>)", perl=T))
but this puts the delimiter > at the end of the each string.
I found related questions are here or here but I can't really get it to work without making a complicated construct.
Is there a simple solution to do this in one go?

Answer 1

Your regex only contains a lookbehind that matches any empty location after a >, see your regex demo. The engine processes a string from left to right, checks if there is a > to the left of the current location, and then returns a valid empty string match if < is found.
You may use (?<=[^>])(?=>) regex:
> res <- unlist(strsplit(a, "(?<=[^>])(?=>)", perl=T))
> res
[1] ">atttaggacctta\nattgtcggta\n" ">ccattnnnn\ncccatt\n"
[3] ">ttaggccta"
> gsub("\n", "", res, fixed=TRUE)
[1] ">atttaggaccttaattgtcggta" ">ccattnnnncccatt"
[3] ">ttaggccta"
The pattern matches a location that is preceded with a non-> char and is followed with > char.
Note that using a lookbehind pattern only with strsplit often leads to unexpected behavior. See Why does strsplit use positive lookahead and lookbehind assertion matches differently?

Answer 2

library(stringi)
library(magrittr)
a <- ">atttaggacctta\nattgtcggta\n>ccattnnnn\ncccatt\n>ttaggccta"
stri_replace_all_regex(a, "\\n", "") %>%
stri_extract_all_regex("(>[[:alpha:]]+)") %>%
unlist()
## [1] ">atttaggaccttaattgtcggta" ">ccattnnnncccatt" ">ttaggccta"
If one must use base only:
a <- gsub("\\n", "", a)
unlist(regmatches(a, gregexpr("(>[[:alpha:]]+)", a)))