I am looking for a sed in which I can recognize all of the text in between two indicators and then replace it with a place holder.
For instance, the 1st indicator is a list of words
(no|noone|haven't)
and the 2nd indicator is a list of punctuation
Code:
(.|,|!)
From an input text such as
"Noone understands the plot. There is no storyline. I haven't
recommended this movie to my friends! Did you understand it?"
The desired result would be.
"Noone understands_AFFIX me_AFFIX. There is no storyline_AFFIX. I
haven't recommended_AFFIX this_AFFIX movie_AFFIX to_AFFIX my_AFFIX
friends_AFFIX! Did you understand it?"
I know that there is the following sed:
sed -n '/WORD1/,/WORD2/p' /path/to/file
which recognizes the content between two indicators. I have also found a lot of great information and resources here. However, I still cannot find a way to append the affix to each token of text that occurs between the two indicators.
I have also considered to use awk, such as
awk '{sub(/.*indic1 /,"");sub(/ indic2.*/,"");print;}' < infile
yet still, it does not allow me to append the affix.
Does anyone have a suggestion to do so, either with awk or sed?
Little more compact awk
$ awk 'BEGIN{RS=ORS=" ";s="_AFFIX"}
/[.,!]$/{f=0; $0=gensub(/(.)$/,"s\\1","g")}
f{$0=$0s}
/Noone|no|haven'\''t/{f=1}1' story
Noone understands_AFFIX the_AFFIX plot_AFFIX. There is no storyline_AFFIX. I haven't recommended_AFFIX this_AFFIX movie_AFFIX to_AFFIX my_AFFIX friends_AFFIX! Did you understand it?
Perl to the rescue!
perl -pe 's/(?:no(?:one)?|haven'\''t)\s*\K([^.,!]+)/
join " ", map "${_}_AFFIX", split " ", $1/egi
' infile > outfile
\K matches what's on its left, but excludes it from the replacement. In this case, it verifies the 1st indicator. (\K needs Perl 5.10+.)
/e evaluates the replacement part as code. In this case, the code splits $1 on whitespace, map adds _AFFIX to each of the members, and join joins them back into a string.
Here is one verbose awk command for the same:
s="Noone understands the plot. There is no storyline. I haven't recommended this movie to my friends! Did you understand it?"
awk -v IGNORECASE=1 -v kw="no|noone|haven't" -v pct='\\.|,|!' '{
a=0
for (i=2; i<=NF; i++) {
if ($(i-1) ~ "\\y" kw "\\y")
a=1
if (a && $i ~ pct "$") {
p = substr($i, length($i), 1)
$i = substr($i, 1, length($i)-1)
}
if (a)
$i=$i "_AFFIX" p
if(p) {
p=""
a=0
}
}
} 1'
Output:
Noone understands_AFFIX the_AFFIX plot_AFFIX. There is no storyline_AFFIX. I haven't recommended_AFFIX this_AFFIX movie_AFFIX to_AFFIX my_AFFIX friends_AFFIX! Did you understand it?
Related
I hope this is an easy fix
I originally wrote a clean and easy script that utilized gawk, I used this first and foremost because when I was solving the original issue was what I found. I now need to adapt it to only use awk.
sample file.fasta:
>gene1
>gene235
ATGCTTAGATTTACAATTCAGAAATTCCTGGTCTATTAACCCTCCTTCACTTTTCACTTTTCCCTAACCCTTCAAAATTTTATATCCAATCTTCTCACCCTCTACAATAATACATTTATTATCCTCTTACTTCAAAATTTTT
>gene335
ATGCTCCTTCTTAATCTAAACCTTCAAAATTTTCCCCCTCACATTTATCCATTATCACCTTCATTTCGGAATCCTTAACTAAATACAATCATCAACCATCTTTTAACATAACTTCTTCAAAATTTTACCAACTTACTATTGCTTCAAAATTTTTCAT
>gene406
ATGTACCACACACCCCCATCTTCCATTTTCCCTTTATTCTCCTCACCTCTACAATCCCCTTAATTCCTCTTCAAAATTTTTGGAGCCCTTAACTTTCAATAACTTCAAAATTTTTCACCATACCAATAATATCCCTCTTCAAAATTTTCCACACTCACCAAC
gawk '/[ACTG]{21,}GG/{print a; print}{a=$0}' file.fasta >"species_precrispr".fasta
what I know works is awk is the following:
awk '/[ACTG]GG/{print a; print}{a=$0}' file.fasta >"species_precrispr".fasta
the culprit therefore is the interval expression of {21,}
What I want it to do is search is for it to match each line that contains at least 21 nucleotides left of my "GG" match.
Can anyone help?
Edit:
Thanks for all the help:
There are various solutions that worked. To reply to some of the comments a more basic example of the initial output and the desired effect achieved...
Prior to awk command:
cat file1.fasta
>gene1
ATGCCTTAACTTTCAATAACTGG
>gene2
ATGGGTGCCTTAACTTTCAATAACTG
>gene3
ATGTCAAAATTTTTCATTTCAAT
>gene4
ATCCTTTTTTTTGGGTCAAAATTAAA
>gene5
ATGCCTTAACTTTCAATAACTTTTTAAAATTTTTGG
Following codes all produced the same desired output:
original code
gawk '/[ACTG]{21,}GG/{print a; print}{a=$0}' file1.fasta
slight modification that adds interval function to original awk version >3.x.x
awk --re-interval'/[ACTG]{21,}GG/{print a; print}{a=$0}' file1.fasta
Allows for modification of val and correct output , untested but should work with lower versions of awk
awk -v usr_count="21" '/gene/{id=$0;next} match($0,/.*GG/){val=substr($0,RSTART,RLENGTH-2);if(gsub(/[ACTG]/,"&",val)>= usr_count){print id ORS $0};id=""}' file1.fasta
awk --re-interval '/^>/ && seq { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS} /^>/{name=$0; seq=""; next} {seq = seq $0 } END { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS }' file1.fasta
Desired output: only grab genes names and sequences of sequences that have 21 nucleotides prior to matching GG
>gene1
ATGCCTTAACTTTCAATAACTGG
>gene5
ATGCCTTAACTTTCAATAACTTTTTAAAATTTTTGG
Lastly just to show the discarded lines
>gene2
ATG-GG-TGCCTTAACTTTCAATAACTG # only 3 nt prior to any GG combo
>gene3
ATGTCAAAATTTTTCATTTCAAT # No GG match found
>gene4
ATCCTTTTTTTTGGGTCAAAATTAAA # only 14 nt prior to any GG combo
Hope this helps others!
EDIT: As per OP comment need to print gene ids too then try following.
awk '
/gene/{
id=$0
next
}
match($0,/.*GG/){
val=substr($0,RSTART,RLENGTH-2)
if(gsub(/[ACTG]/,"&",val)>=21){
print id ORS $0
}
id=""
}
' Input_file
OR one-liner form of above solution as per OP's request:
awk '/gene/{id=$0;next} match($0,/.*GG/){val=substr($0,RSTART,RLENGTH-2);if(gsub(/[ACTG]/,"&",val)>=21){print id ORS $0};id=""}' Input_file
Could you please try following, written and tested with shown samples only.
awk '
match($0,/.*GG/){
val=substr($0,RSTART,RLENGTH-2)
if(gsub(/[ACTG]/,"&",val)>=21){
print
}
}
' Input_file
OR more generic approach where created a variable in which user could mention value which user is looking to match should be present before GG.
awk -v usr_count="21" '
match($0,/.*GG/){
val=substr($0,RSTART,RLENGTH-2)
if(gsub(/[ACTG]/,"&",val)>=usr_count){
print
}
}
' Input_file
Explanation: Adding detailed explanation for above.
awk ' ##Starting awk program from here.
match($0,/.*GG/){ ##Using Match function to match everything till GG in current line.
val=substr($0,RSTART,RLENGTH-2) ##Storing sub-string of current line from RSTART till RLENGTH-2 into variable val here.
if(gsub(/[ACTG]/,"&",val)>=21){ ##Checking condition if global substitution of ACTG(with same value) is greater or equal to 21 then do following.
print ##Printing current line then.
}
}
' Input_file ##Mentioning Input_file name here.
GNU awk accepts interval expressions in regular expressions from version 3.0 onwards. However, only from version 4.0, interval expression became defaultly enabled. If you have awk 3.x.x, you have to use the flag --re-interval to enable them.
awk --re-interval '/a{3,6}/{print}' file
There is an issue that often people overlook with FASTA files and using awk. When you have multi-line sequences, it is possible that your match is covering multiple lines. To this end you need to combine your sequences first.
The easiest way to process FASTA files with awk, is to build up a variable called name and a variable called seq. Every time you read a full sequence, you can process it. Remark that, for the best way of processing, the sequence, should be stored as a continues string, and not contain any newlines or white-spaces due. A generic awk for processing fasta, looks like this:
awk '/^>/ && seq { **process_sequence_here** }
/^>/{name=$0; seq=""; next}
{seq = seq $0 }
END { **process_sequence_here** }' file.fasta
In the presented case, your sequence processing looks like:
awk '/^>/ && seq { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS}
/^>/{name=$0; seq=""; next}
{seq = seq $0 }
END { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS }' file.fasta
Sounds like what you want is:
awk 'match($0,/[ACTG]+GG/) && RLENGTH>22{print a; print} {a=$0}' file
but this is probably all you need given the sample input you provided:
awk 'match($0,/.*GG/) && RLENGTH>22{print a; print} {a=$0}' file
They'll both work in any awk.
Using your updated sample input:
$ awk 'match($0,/.*GG/) && RLENGTH>22{print a; print} {a=$0}' file
>gene1
ATGCCTTAACTTTCAATAACTGG
>gene5
ATGCCTTAACTTTCAATAACTTTTTAAAATTTTTGG
I am trying to filter out text between two patterns, I've seen a dozen examples but didn't manage to get exactly what I want:
Sample input:
START LEAVEMEBE text
data
START DELETEME text
data
more data
even more
START LEAVEMEBE text
data
more data
START DELETEME text
data
more
SOMETHING that doesn't start with START
# sometimes it starts with characters that needs to be escaped...
I want to stay with:
START LEAVEMEBE text
data
START LEAVEMEBE text
data
more data
SOMETHING that doesn't start with START
# sometimes it starts with characters that needs to be escaped...
I tried running sed with:
sed 's/^START DELETEME/,/^[^ ]/d'
And got an inclusive removal, I tried adding "exclusions" (not sure if I really understand this syntax well):
sed 's/^START DELETEME/,/^[^ ]/{/^[^ ]/!d}'
But my "START DELETEME" line is still there (yes, I can grep it out, but that's ugly :) and besides - it DOES remove the empty line in this sample as well and I'd like to leave empty lines if they are my end pattern intact )
I am wondering if there is a way to do it with a single sed command.
I have an awk script that does this well:
BEGIN { flag = 0 }
{
if ($0 ~ "^START DELETEME")
flag=1
else if ($0 !~ "^ ")
flag=0
if (flag != 1)
print $0
}
But as you know "A is for awk which runs like a snail". It takes forever.
Thanks in advance.
Dave.
Using a loop in sed:
sed -n '/^START DELETEME/{:l n; /^[ ]/bl};p' input
GNU sed
sed '/LEAVEMEBE/,/DELETEME/!d;{/DELETEME/d}' file
I would stick with awk:
awk '
/LEAVE|SOMETHING/{flag=1}
/DELETE/{flag=0}
flag' file
But if you still prefer sed, here's another way:
sed -n '
/LEAVE/,/DELETE/{
/DELETE/b
p
}
' file
I am working on a project that takes a delimited set of data of the form:
field1~field2~field3~.....~fieldn
Having empty fields is a possibility, so
field1~~~field4~~field6
is perfectly acceptable.
This file gets translated using an inhouse translator program that leaves a little to be desired. Specifically, it doesn't deal with empty fields well. My solution was to stick some dummy value in there, like a space or an # sign. I've tried:
sed -r 's/~/~ ~/g'
and
awk '{gsub(/\~\~/,"~ ~")}; 1' file > file.SPACE
but both of these fall short in replacing MULTIPLE fields. So if I input
field1~field2~~~field3
it'll output:
field1~field2~ ~~field3
I'd like to just script this if I could, as I can't change the code of the translator. I can change the code in the program that creates the delimited file, but I'd rather not. Is there some workaround, or is coming up with an expression for this just one of the inherent limitations in a regular language?
EDIT: Wow thanks for the quick response everyone, all your solutions worked so I upvoted all of them. I think I'm going to accept Janito's because of the explanation.
Also why the downvote?
You could try:
sed -e ':a;s/~~/~ ~/;ta'
This creates a label "a" with the ":" command, then replaces one occurrance of ~~ with ~ ~, and then uses the "t" test command to jump back to the "a" label if the previous substitute command succeeded.
Hope this helps =)
awk '{for( i=0; i<=NF; i++ ) if( $i ~ /^$/ ) $i = " " } 1' FS='~' OFS='~' input
or:
awk '/^$/{ $0 = " " } 1' ORS='~' RS='~' input
or:
awk '{ while( gsub( "~~", "~ ~" )); }1' input
sed -e ':loop' -e 's/~~/~ ~/g' -e 't loop' file
You can use Perl
perl -pe 's/~(?=~)/~ /g'
...which says replace each "~" followed by "~" with "~ "
To store result(s) to file.SPACE use
perl -pe 's/~(?=~)/~ /g' file >file.SPACE
Many people say we can do without lazy quantifiers in regular expressions, but I've just run into a problem that I can't solve without them (I'm using sed here).
The string I want to process is composed of substrings separated by the word rate, for example:
anfhwe9.<<76xnf9247 rate 7dh3_29snpq+074j rate 48jdhsn3gus8 rate
I want to replace those substrings (apart from the word 'rate') with 3 dashes (---) each; the result should be:
---rate---rate---rate
From what I understand (I don't know Perl), it can be easily done using lazy quantifiers. In vim there are lazy quantifiers too; I did it using this command
:s/.\{-}rate/---rate/g
where \{-} tells vim to match as few as possible.
However, vim is a text editor and I need to run the script on many machines, some of which have no Perl installed. It could also be solved if you can tell the regex to not match an atomic grouping like .*[^(rate)]rate but that did not work.
Any ideas how to achieve this using POSIX regex, or is it impossible?
In a case like this, I would use split():
perl -n -e 'print join ("rate", ("---") x split /rate/)' [input-file]
Are there any characters that are guaranteed not to be in the input? For instance, if '!'
can't occur, you could transform the input to substitute that unique character, and then do a global replace on the transformed input:
sed 's/ rate /!/g' < input | sed -e 's/[^!]*/---/g' -e 's/!/rate/g'
Another alternative is to use awk's split command in an analogous way to
the perl suggestion above, assuming awk is any more reliably available than perl.
awk '
{ ans="---"
n=split($0, x, / rate /);
while ( n-- ) { ans = ans "rate---";}
print ans
}'
It's not easy without using lazy quantifiers or negative lookaheads (neither of which POSIX supports), but this seems to work.
([^r]*((r($|[^a]|a([^t]|$)|at([^e]|$))))?)+rate
I vaguely recall POSIX character classes being a bit persnickety. You may need to alter the character classes in that regex if they're not already POSIX-compliant.
The fact that you don't care about the contents of the substrings opens up a lot of options. For example, to add to Bob Lied's suggestion — even if '!' can occur in the input, you can start by changing it to something else:
sed -e 's/!/./g' -e 's/rate/!/g' -e 's/[^!]\+/---/g' -e 's/!/rate/g' <input >output
With awk:
awk -Frate '{
for (i = 0; ++i <= NF;)
$i = (i == 1 || i == NF) && $i == x ? x : "---"
}1' OFS=rate infile
Or, awk 'BEGIN {OFS=FS="rate"} {for (i=1; i<=NF-1; i++) {$i = "---"}; print}'
I'm stil pretty new to regular expression and just started learning to use awk. What I am trying to accomplish is writing a ksh script to read-in lines from text, and and for every lines that match the following:
*RECORD 0000001 [some_serial_#]
to replace $2 (i.e. 000001) with a different number. So essentially the script read in batch record dump, and replace the record number with date+record#, and write to separate file.
So this is what I'm thinking the format should be:
awk 'match($0,"/*RECORD")!=0{$2="$DATE-n++"; print $0} match($0,"/*RECORD")==0{print $0}' $BATCH > $OUTPUT
but obviously "/*RECORD" is not going to work, and I'm not sure if changing $2 and then write the whole line is the correct way to do this. So I am in need of some serious enlightenment.
So you want your example line to look like
*RECORD $DATE-n++ [some_serial_#]
after awk's done with it?
awk '{ if (match($0, "*RECORD") != 0) { $2="$DATE-n++"; }; print }' $BATCH > $OUTPUT
Based on your update, it looks like you instead expect $DATE to be an environment variable which is used in the awk expression and n is a variable in the awk script that keeps count of how many records matched the pattern. Given that, this may look more like what you want.
$ cat script.awk
BEGIN { n=0 }
{
if (match($0, "\*RECORD") != 0) {
n++;
$2 = (ENVIRON["DATE"] "-" n);
}
print;
}
$ awk -f script.awk $BATCH > $OUTPUT
use equality.
D=$(date +%Y%m%d)
awk -vdate="$D" '
{
for(i=1;i<=NF;i++){
if ( $i == "*RECORD" ){
$(i+1) = date"00002"
break # break after searching for one record, otherwise, remove break
}
}
}1' file