RNA to protein. Program compiles but won't stop running - c++

Question

I recently learned about multidimensional arrays and was given the task of analyzing strands of RNA and translating them into sequences of protein. I decided to use my knowledge of multidimensional arrays to create a definition of each amino acid a codon (group of 3 RNA bases) would translate to.
//RNA codon to amino acid mapping
char aminoAcid[4][4][4];
//A = 0, C = 1, G = 2, U = 3
//phenylalanine - F
aminoAcid[3][3][3] = 'F';
aminoAcid[3][3][1] = 'F';
//Leucine - L
aminoAcid[3][3][0] = 'L';
aminoAcid[3][3][2] = 'L';
//Serine - S
aminoAcid[3][1][3] = 'S';
aminoAcid[3][1][1] = 'S';
aminoAcid[3][1][0] = 'S';
aminoAcid[3][1][2] = 'S';
//tyrosine - Y
aminoAcid[3][0][3] = 'Y';
aminoAcid[3][0][1] = 'Y';
//stop codon
aminoAcid[3][0][0] = '-';
aminoAcid[3][0][2] = '-';
//cysteine - C
aminoAcid[3][2][3] = 'C';
aminoAcid[3][2][1] = 'C';
//stop codon
aminoAcid[3][2][0] = '-';
//tryptophan - W
aminoAcid[3][2][2] = 'W';
//leucine - L
aminoAcid[1][3][3] = 'L';
aminoAcid[1][3][1] = 'L';
aminoAcid[1][3][0] = 'L';
aminoAcid[1][3][2] = 'L';
//proline - P
aminoAcid[1][1][3] = 'P';
aminoAcid[1][1][1] = 'P';
aminoAcid[1][1][0] = 'P';
aminoAcid[1][1][2] = 'P';
//histidine - H
aminoAcid[1][0][3] = 'H';
aminoAcid[1][0][1] = 'H';
//glutamine - Q
aminoAcid[1][0][0] = 'Q';
aminoAcid[1][0][2] = 'Q';
//arginine - R
aminoAcid[1][2][3] = 'R';
aminoAcid[1][2][1] = 'R';
aminoAcid[1][2][0] = 'R';
aminoAcid[1][2][2] = 'R';
//isoleucine - I
aminoAcid[0][3][3] = 'I';
aminoAcid[0][3][1] = 'I';
aminoAcid[0][3][0] = 'I';
//methionine(start codon) - M
aminoAcid[0][3][2] = 'M';
//threonine -T
aminoAcid[0][1][3] = 'T';
aminoAcid[0][1][1] = 'T';
aminoAcid[0][1][0] = 'T';
aminoAcid[0][1][2] = 'T';
//asparagine - N
aminoAcid[0][0][3] = 'N';
aminoAcid[0][0][1] = 'N';
//lysine - K
aminoAcid[0][0][0] = 'K';
aminoAcid[0][0][2] - 'K';
//serine - S
aminoAcid[0][2][3] = 'S';
aminoAcid[0][2][1] = 'S';
//arginine - R
aminoAcid[0][2][0] = 'R';
aminoAcid[0][2][2] = 'R';
//valine - V
aminoAcid[2][3][3] = 'V';
aminoAcid[2][3][1] = 'V';
aminoAcid[2][3][0] = 'V';
aminoAcid[2][3][2] = 'V';
//alanine - A
aminoAcid[2][1][3] = 'A';
aminoAcid[2][1][1] = 'A';
aminoAcid[2][1][0] = 'A';
aminoAcid[2][1][2] = 'A';
//aspartic acid - D
aminoAcid[2][0][3] = 'D';
aminoAcid[2][0][1] = 'D';
//glutamic acid - E
aminoAcid[2][0][0] = 'E';
aminoAcid[2][0][2] = 'E';
//glycine - G
aminoAcid[2][2][3] = 'G';
aminoAcid[2][2][1] = 'G';
aminoAcid[2][2][0] = 'G';
aminoAcid[2][2][2] = 'G';
I created the following function to translate the strand. In this case, please note that my rna strand is:
AUGCUUAUUAACUGAAAACAUAUGGGUAGUCGAUGA
string rnaAnalysis::translateRna()
{
string protein = "";
int firstBase, secondBase, thirdBase;
for(int i = 0; i < newSequence.length() - 2; i+3)
{
if(newSequence[i] == 'A')
{
firstBase = 0;
}
else if(newSequence[i] == 'C')
{
firstBase = 1;
}
else if(newSequence[i] == 'G')
{
firstBase = 2;
}
else if(newSequence[i] == 'U')
{
firstBase = 3;
}
if(newSequence[i+1] == 'A')
{
secondBase = 0;
}
else if(newSequence[i+1] == 'C')
{
secondBase = 1;
}
else if(newSequence[i+1] == 'G')
{
secondBase = 2;
}
else if(newSequence[i+1] == 'U')
{
secondBase = 3;
}
if(newSequence[i+2] == 'A')
{
thirdBase = 0;
}
else if(newSequence[i+2] == 'C')
{
thirdBase = 1;
}
else if(newSequence[i+2] == 'G')
{
thirdBase = 2;
}
else if(newSequence[i+2] == 'U')
{
thirdBase = 3;
}
bool readSequence = true;
if (aminoAcid[firstBase][secondBase][thirdBase] == aminoAcid[0][3][2])
{
readSequence = true;
}
else if (aminoAcid[firstBase][secondBase][thirdBase] == aminoAcid[3][0][0] ||
aminoAcid[firstBase][secondBase][thirdBase] == aminoAcid[3][0][2] ||
aminoAcid[firstBase][secondBase][thirdBase] == aminoAcid[3][2][0])
{
readSequence = false;
}
if(readSequence)
{
protein = protein + aminoAcid[firstBase][secondBase][thirdBase] + " ";
}
else
{
continue;
}
}
return protein;
}
The bool is used for "start codons" and "stop codons", basically codons within the strand that will tell you when to record and when to stop. newSequence would be the RNA strand.
EDIT: I'm fairly new at this, so I understand my code may look really ugly. Any feedback on how to clean it up is much appreciated as well.

Answer 1

for(int i = 0; i < newSequence.length() - 2; i+3)
should be
for(int i = 0; i < newSequence.length() - 2; i += 3)
Your code never changes the value of i which is why it never stops running.
Your loop starts with the same piece of code three times, where you convert the letter to the 'base index'. That's an obvious place to use a function
for (int i = 0; i < newSequence.length() - 2; i += 3)
{
int firstBase = baseIndex(newSequence[i]);
int secondBase = baseIndex(newSequence[i + 1]);
int thirdBase = baseIndex(newSequence[i + 2]);
...
I'll leave you to write the baseIndex function.