Create multiple output files and cut dna with enzymes - Perl - regex

Question

I am a first year grad student who's relatively new in computational biology. I recently started using Perl and it's not the easiest language to learn, at least not for me.
I need help applying my idea/logic the right way to figure out the solution to my problem.
I have a dna string and I want to split it at specific sites to get multiple fragments using information from an enzyme file that contains lines of recognition sites. Once the fragments are obtained, I want to output the list of dna fragments in an output file. I want to create an output file for every line in the enzyme file I am going to extract the information from, to apply it to the dna string.
Here's what I mean exactly:
Hypothetical scenario:
Enzyme.File contains:
abc/at'gtct// (abc is the name of the enzyme. (atgtct) is the recognition site.)
def/cgg'ataaa// ........
Suppose the dna string is: $dna = "accggttatgtctaaacggataaagtctcggataaattt" (recognition sites are bolded)
For line 1
When I extract the info from the first line/enzyme(abc) from the enzyme file and apply it to this string, the output should be:
accggttat
gtctaaacggataaagtctcggataaattt
(split between cgg'ataaa) the apostrophe represents the cut point
(note: Even though there is another gtct in the string, it does not split it because at ought to precede it.)
For line 2
$dna = accggttatgtctaaacggataaagtctcggataaattt (Info is applied to same dna string)
Info from line/enzyme 2 (def) would split the dna as follow:
accggttatgtctaaacgg (split between cgg'ataaa)
ataaagtctcgg
ataaattt
I want to put each output from the different lines in separate file with distinct names. (I can take care of assigning the names)
So in conclusion, this example would create two new files, one name "abc_whatever" and "def_whatever". Important: If the enzyme file had 8 lines with different enzymes, I would get 8 new output files with their distinct dna fragments."
Here's what I've tried so far:
#!/usr/bin/perl;
use warnings;
use strict;
open(ENZ,$ARGV[0]) || die; # ENZ(file handle for enzyme file)
my $dna = "accggttatgtctaaacggataaagtctcggataaattt";
while (<ENZ>) {
if ( match pattern etc..) { # I took care of that and created captured groups of
$1 = holds "abc" # the info I needed from the line e.g. I captured
$2 = ..."at" # (abc)/(at)'(gtct)//, so they are stored in $1,$2,$3
$3 = ..."gtct" # respectively
}
while (<$dna>){
my #fragments_array = split(/$3/, $dna);
open (OutFile, ">$dna"."_"."$1")
print OutFile shift #fragments_array,"\n";
foreach (#fragments_array) {
print OutFile "$3$_\n";
close OutFile;
}
}
}
close ENZ;
FIRST
I can only create an output only for the 1st line in the Enzyme file. I want to create and output file for all the lines.
SECOND
I am not properly cutting the dna. From other examples I have seen online, it looks like I am gonna have to use the following functions to properly apply the enzyme information on the dna. The functions include:
the for loop, length and substr(),
If you can, please demonstrate your work in the simplest form (no extravagant, impressing codes lol :-) since I am just learning this language)
Thanks in advance!

Answer 1

FIRST I can only create an output only for the 1st line in the Enzyme file. I want to create and output file for all the lines.
That's simply because you put close OutFile; into the foreach (#fragments_array) loop, instead of placing the close after the loop body.
SECOND I am not properly cutting the dna.
That's because you forgot to include $2, the head of the recognition site (e. g. the at of atgtct) in the split pattern as well as in the output.
The problem is solved easier if we just insert the splitting new-line character everywhere between the head and the tail:
#!/usr/bin/perl
use warnings;
use strict;
open(ENZ, $ARGV[0]) || die; # ENZ (file handle for enzyme file)
my $dna = "accggttatgtctaaacggataaagtctcggataaattt";
while (<ENZ>)
{
if (m-(.*)/(.*)'(.*)//-)
{
my ($head, $tail) = ($2, $3); # $2$3 is the recognition site; save it
open(OutFile, ">${dna}_$1");
(my $fragments = $dna) =~ s/$head$tail/$head\n$tail/g; # insert NLs
print OutFile $fragments, "\n";
close OutFile;
}
}
close ENZ;

Answer 2

I changed your code a bit, hope it works now
#!/usr/bin/perl
use warnings;
use strict;
open(ENZ, $ARGV[0]);
my $dna = "accggttatgtctaaacggataaagtctcggataaattt";
my ($enzyme, $first, $second) = ("", "", "");
for my $line (<ENZ>) {
chomp($line); # remove \n at the end of string
my #elements = split(/\/|'/, $line); # split string into tokens (e.g. abc/at'gtct => array(abc, at, gtct))
$elements[2] = substr($elements[2], 0, -2); # remove the last "//"
my ($firstPart, $secondPart) = ($elements[1], $elements[2]);
if ($dna =~ /(.*)$firstPart$secondPart(.*)/) {
$first = $1 . $firstPart;
$second = $2 . $secondPart;
$enzyme = $elements[0];
open(OUTPUT, ">$enzyme" . "_something");
print OUTPUT "$first\n$second\n";
close(OUTPUT);
}
}
close ENZ;
EDIT: this is the working version. I suggest you learn how to use Regular Expression if you want to use Perl for your study. It is the strongest tool in Perl.