I have a document containing a series of strings between hundreds of [] and I want to highlight the strings and copy the information into a spreadsheet.
I have attempted using the Find tool but cannot figure out the regex expression
The final goal of this would be to be able to copy the information in one go into a new file, or highlight it and copy into an excel spreadsheet.
Text file something like:
>X_343435353.3 words like foo bar [Wanted text]
TGATGATGCCATGCTAGCCATCGACTAGCGACTAGCATCGACTAGCATCAGCTACGACTAGCATCGACTACGA
>XP_543857836.3 other information [Text that I want]
TAGCATCGACTAGCTACTACCTGAGCGAGAAATTTTGGCTATCGACATCGACTATCGAGCACAGCTAGGAATT
>NP_3843875938.2 interesting words [Third desired text]
ATCGCATAGCGCGCTTAGAAGGCCTTAGAGGCATCATCTATCGAGCGACGATATCGCGAGGCAGCGCTATACC
The ouput I desire is as follows:
Wanted text
Text that I want
Third desired text
I am not sure if it is possible to do this in Notepad++ or if you need to use a cmd/shell tool to do it. I am using a Windows 10. The thought was that it may be possible to highlight all of the desired text with a regex that can then be copied elsewhere.
To match just the text and not the brackets:
(?<=\[).*?(?=\])
Example:
To delete everything in a document and leave just the wanted text on each line:
Set the cursor at the start of the document.
Macro, Start recording.
Ctrl-F (Find), .*?\[, Select regular expression and . matches newline.
Click Find Next and close the dialog.
Delete the highlighted text.
Ctrl-F (Find), \], Select regular expression and . matches newline.
Click Find Next and close the dialog.
Hit Enter to delete the highlighted text.
Macro, Stop recording.
Macro, Run a macro multiple times, select Until end of file.
Click Run.
Result:
Wanted text
Text that I want
Third desired text
You'll need to delete the last bit after the final match (if any) once the macro completes.
Maybe this expression,
.*\[(.*?)\][\s\S]+?([\r\n]|$)
with a replacement of $1\n also might work.
The expression is explained on the top right panel of this demo if you wish to explore/simplify/modify it.
This one is working fine for me ....
Find what: >.*?\[(.*?)\]\n.*
Replace with: $1
In notepad ++, I want to select text up to a certain text match, including the match.
The txt file I am working with contains a lot of text with also white characters, returns and some special characters. In this text, there are characters that mark an end. Let's call these stop characters "ZZ." for now.
Using RegEx, I tried to create an expression that finds the next "ZZ." and selects everything before it. This is what it looks like:
+., \c ZZ.\n
But I seem to have gotten something wrong. As it is a similar to this
problem, I tried to use their RegEx with slight modification. Here is a picture so you can figure what I'd like to accomplish:
Find the next stop marker, selext the marker and everything before it.
In the actual file, the stop marker is "გვ."
If I want to use those, maybe I need to change the RegEx even more, as those are no ASCII characters? Like so, as stated in the RegEx Wiki?
\c+ (\x{nnnn}\x{nnnn}.)\n
Not quite sure if the \c works that way. I have seen expressions that use something like (A-Za-z)(0-9) but this is a different alphabet.
To match any text up to and including some pattern, use .*? (to match any zero or more characters, as few as possible) with the . matches newline option ON and add the გვ after it:
I am using visual studio code for several things. Everything is working fine, but I cannot get one specific thing to work.
I need the ability to remove line breaks from the text.
Example:
first line
second line
Should become:
first linesecondline
Since a recent update it is possible to search for line breaks with using ^$.
It is described here: https://github.com/Microsoft/vscode/pull/314
The problem I have is that when I use this for replacing, it does actually "add" to the line break and does not "replace" it.
The latest version of VS Code has a shortcut to join lines (some may say remove breaks) from selection: CTRL + J.
I found that (at least on Windows) the solution was to use search and replace with a regular expression. Search for $\n and replace with nothing to get rid of the newlines. Note that the newline character that we want to replace is placed after the end of line matcher ($).
#tripleonard hint did not work for me (no shortcut key assigned), so what I did was first ctrl+shift+p to list all commands and then just type Join lines
I'm able to manage this with the search and replace tool and "Use Regular Expression" enabled. Search for the pattern \n$ and replace with $
In my case shorcut in VS Code was not set. It took me a while to find out what command in VS Code am I looking for. For other with same problem it is: "Join lines".
Turn on regex mode and find and replace.
Search for \n and replace with nothing.
Select the new line, and press ctrl+D (and hold it).
Then press ctrl+h, you will be able to replace it with whatever you need.
On Mac, use cmd+a to select all lines. Then, use cmd+shift+p to open commands and type Join Line and click on it.
You can use \n to search for new lines
but while finding/searching,
the Use Regular Expression option should be enabled
Press ctrl+f or ctrl + h
Copy and past this ^(\s)*$\n expression into top input field
after click on the * icon, then you can see all white lines break.
Past bottom input field = \n //one line break
That means what you want to replate in white line break
After click on the Replace or Replace All Icon button
https://bitcoden.com/answers/visual-studio-code-delete-all-blank-lines-regex
Eclipse regexp search works pretty well, so for example in search box I have this:
(?s)(myMethod.*?;)\}\);
Now I want to copy multiline text in the IDE and in replace box, for example I want to paste \1PASTE_MULTILINE_TEXT_HERE. However Eclipse does not allow me to directly copy-paste multiline text without manually inserting newline characters.
In Vim (Gvim, Macvim) it works perfectly well, keeping all the spaces; how can I do the same thing in Eclipse?
For searching multiple lines in Eclipse, you must use the 's' parameter in search expression:
(?s)someExpressionToMatchInAnyLine
For replacing with multiple lines exp you must use \R i.e:
line1\Rline2\Rline3
This will replace the matched exp with:
line1
line2
line3
Generally, the approach I've taken to doing this sort of thing is to type out what I want to use as a replacement, select that, open up the Find/Replace dialog, and copy the contents of the Find text box. I proceed from there and paste what I copied into the Replace text box. There is still a little work to be done (removing backslashes from in front of regex special characters that don't apply in the Replace box), but it gives me a hand up.
How can I find/replace all CR/LF characters in Notepad++?
I am looking for something equivalent to the ^p special character in Microsoft Word.
[\r\n]+ should work too
Update March, 26th 2012, release date of Notepad++ 6.0:
OMG, it actually does work now!!!
Original answer 2008 (Notepad++ 4.x) - 2009-2010-2011 (Notepad++ 5.x)
Actually no, it does not seem to work with regexp...
But if you have Notepad++ 5.x, you can use the 'extended' search mode and look for \r\n. That does find all your CRLF.
(I realize this is the same answer than the others, but again, 'extended mode' is only available with Notepad++ 4.9, 5.x and more)
Since April 2009, you have a wiki article on the Notepad++ site on this topic:
"How To Replace Line Ends, thus changing the line layout".
(mentioned by georgiecasey in his/her answer below)
Some relevant extracts includes the following search processes:
Simple search (Ctrl+F), Search Mode = Normal
You can select an EOL in the editing window.
Just move the cursor to the end of the line, and type Shift+Right Arrow.
or, to select EOL with the mouse, start just at the line end and drag to the start of the next line; dragging to the right of the EOL won't work.
You can manually copy the EOL and paste it into the field for Unix files (LF-only).
Simple search (Ctrl+F), Search Mode = Extended
The "Extended" option shows \n and \r as characters that could be matched.
As with the Normal search mode, Notepad++ is looking for the exact character.
Searching for \r in a UNIX-format file will not find anything, but searching for \n will. Similarly, a Macintosh-format file will contain \r but not \n.
Simple search (Ctrl+F), Search Mode = Regular expression
Regular expressions use the characters ^ and $ to anchor the match string to the beginning or end of the line. For instance, searching for return;$ will find occurrences of "return;" that occur with no subsequent text on that same line. The anchor characters work identically in all file formats.
The '.' dot metacharacter does not match line endings.
[Tested in Notepad++ 5.8.5]: a regular expression search with an explicit \r or \n does not work (contrary to the Scintilla documentation).
Neither does a search on an explicit (pasted) LF, or on the (invisible) EOL characters placed in the field when an EOL is selected.
Advanced search (Ctrl+R) without regexp
Ctrl+M will insert something that matches newlines. They will be replaced by the replace string.
I recommend this method as the most reliable, unless you really need to use regex.
As an example, to remove every second newline in a double spaced file, enter Ctrl+M twice in the search string box, and once in the replace string box.
Advanced search (Ctrl+R) with Regexp.
Neither Ctrl+M, $ nor \r\n are matched.
The same wiki also mentions the Hex editor alternative:
Type the new string at the beginning of the document.
Then select to view the document in Hex mode.
Select one of the new lines and hit Ctrl+H.
While you have the Replace dialog box up, select on the background the new replacement string and Ctrl+C copy it to paste it in the Replace with text input.
Then Replace or Replace All as you wish.
Note: the character selected for new line usually appears as 0a.
It may have a different value if the file is in Windows Format. In that case you can always go to Edit -> EOL Conversion -> Convert to Unix Format, and after the replacement switch it back and Edit -> EOL Conversion -> Convert to Windows Format.
It appears that this is a FAQ, and the resolution offered is:
Simple search (Ctrl+H) without regexp
You can turn on View/Show End of Line
or view/Show All, and select the now
visible newline characters. Then when
you start the command some characters
matching the newline character will be
pasted into the search field. Matches
will be replaced by the replace
string, unlike in regex mode.
Note 1: If you select them with the
mouse, start just before them and drag
to the start of the next line.
Dragging to the end of the line won't
work.
Note 2: You can't copy and paste
them into the field yourself.
Advanced search (Ctrl+R) without regexp
Ctrl+M will insert something that matches newlines. They will be replaced by the replace string.
On the Replace dialog, you want to set the search mode to "Extended". Normal or Regular Expression modes wont work.
Then just find "\r\n" (or just \n for unix files or just \r for mac format files), and set the replace to whatever you want.
I've not had much luck with \r\n regular expressions from the find/replace window.
However, this works in Notepad++ v4.1.2:
Use the "View | Show end of line" menu to enable display of end of line characters.
(Carriage return line feeds should show up as a single shaded CRLF 'character'.)
Select one of the CRLF 'characters' (put the cursor just in front of one, hold down the SHIFT key, and then pressing the RIGHT CURSOR key once).
Copy the CRLF character to the clipboard.
Make sure that you don't have the find or find/replace dialog open.
Open the find/replace dialog.
The 'Find what' field shows the contents of the clipboard: in this case the CRLF character - which shows up as 2 'box characters' (presumably it's an unprintable character?)
Ensure that the 'Regular expression' option is OFF.
Now you should be able to count, find, or replace as desired.
Image with CRLF
Image without CRLF
The way I found it to work is by using the Replace function, and using "\n", with the "Extended" mode. I'm using version 5.8.5.
In 2013, v6.13 or later, use:
Menu Edit → EOL Conversion → Windows Format.
To find any kind of a line break sequence use the following regex construct:
\R
To find and select consecutive line break sequences, add + after \R: \R+.
Make sure you turn on Regular expression mode:
It matches:
U+000DU+000A -CRLF` sequence
U+000A - LINE FEED, LF
U+000B - LINE TABULATION, VT
U+000C - FORM FEED, FF
U+000D - CARRIAGE RETURN, CR
U+0085 - NEXT LINE, NEL
U+2028 - LINE SEPARATOR
U+2029 - PARAGRAPH SEPARATOR
Assuming it has a "regular expressions" search, look for \r\n. I prefer \r?\n, because some files don't use carriage returns.
EDIT: Thanks for the feedback, whoever voted this down. I have learned that... well, nothing, because you provided no feedback. Why is this wrong?
Use the advanced search option (Ctrl + R) and use the keyboard shortcut for CRLF (Ctrl + M) to insert a carriage return.
If you need to do a complex regexp replacement including \r\n, you can workaround the limitation by a three-step approach:
Replace all \r\n by a tag, let's say #GO# → Check 'Extended', replace \r\n by #GO#
Perform your regexp, example removing multiline ICON="*" from an html bookmarks → Check regexp, replace ICON=.[^"]+.> by >
Put back \r\n → Check 'Extended', replace #GO# by \r\n
Go to View--> Show symbol-->Show all character
// Its worked for me
Make this setting. Menu-> View-> Show Symbol-> uncheck Show End of the Line
I opened the file in Notepad++ and did a replacement in a few steps:
Replace all "\r\n" with " \r\n"
Replace all "; \r\n" with "\r\n"
Replace all " \r\n" with " "
This puts all the breaks where they should be and removes those that are breaking up the file.
It worked for me.
I was totally unable to do this in NP v6.9.
I found it easy enough on Msoft Word (2K).
Open the doc, go to edit->replace.
Then in the bottom of the search box, click "more" then find the "Special" button and they have several things for you. For Dos style, I used the "paragraph" one. This is a cr lf pair in windows land.
Just do a \r with a find and replace with a blank in the replace field so everything goes up to one line. Then do a find and replace (in my case by semi colon) and replace with ;\n
:)
-T&C
To change a document of separate lines into a single line, with each line forming one entry in a comma separated list:
ctrl+f to open the search/replacer.
Click the "Replace" tab.
Fill the "Find what" entry with "\r\n".
Fill the "Replace with" entry with "," or ", " (depending on preference).
Un-check the "Match whole word" checkbox (the important bit that eludes logic).
Check the "Extended" radio button.
Click the "Replace all" button.
These steps turn e.g.
foo bar
bar baz
baz foo
into:
foo bar,bar baz,baz foo
or: (depending on preference)
foo bar, bar baz, baz foo
Maybe you can use TextFX plugins
In TextFX, go to textfx edit → delete blank lines