I am writing a simple app that outputs all files in some directory to console. To achieve this I dynamically allocate memory in function PathCreator() and return a pointer to this memory. I don't know how to correctly free this memory segment in GetAllFiles(). When I use the code below I get a stack overflow exception. How can I fix this? Please don't offer me to use something that doesn't need dynamically allocated memory, I just want to fix my code.
#include "stdafx.h"
#include <windows.h>
#include <iostream>
wchar_t *PathCreator(wchar_t *dir, wchar_t *fileName);
int is_directory(wchar_t *p)
{
wchar_t *t = PathCreator(p,L"\\");
WIN32_FIND_DATA file;
HANDLE search_hendle = FindFirstFile(t, &file);
long error = GetLastError();
if(error == 267)
{
return 0;
}
else
{
return 1;
}
}
wchar_t *PathCreator(wchar_t *dir, wchar_t *fileName)
{
wchar_t* path = 0;
int size = 0;
wchar_t *d = dir;
wchar_t *f = fileName;
while(*d != '\0')
{
d++;
size++;
}
while(*f != '\0')
{
f++;
size++;
}
path = new wchar_t[(size+=3) * sizeof(wchar_t)];
int j = 0;
while(j < size)
{
path[j] = '\0';
j++;
}
int i;
i = 0;
while(*dir != '\0')
{
path[i] = *dir;
i++;
dir++;
}
path[i++] = '\\';
wchar_t *t = fileName;
while(*t != '\0')
{
path[i] = *t;
i++;
t++;
}
path[i] = '\0';
return path;
}
void GetAllFiles(wchar_t* dir)
{
wchar_t *p = 0;
int i = 0;
WIN32_FIND_DATA file;
wchar_t *t = PathCreator(dir, L"*");
HANDLE search_hendle = FindFirstFile(t, &file);
if(search_hendle)
{
do
{
p = PathCreator(dir,file.cFileName);
if(!is_directory(p))
{
std::wcout << p << std::endl;
}
else
{
GetAllFiles(p);
}
delete [] p;
}
while(FindNextFile(search_hendle, &file));
}
delete [] t;
FindClose(search_hendle);
}
int _tmain(int argc, _TCHAR* argv[])
{
GetAllFiles(L"C:\\Users");
}
So, you have "." and ".." in your directory search.
The first entry is ".", so:
p = PathCreator(dir, file.cFilename)
yields:
"C:\Users\."
Then the next line:
if (!is_directory(p))
Is ALWAYS false, so it just keeps recursing into:
GetAllFiles(p)
forever ... or until your stack blows up, whichever comes first ;-)
I would recommend explicitly checking for "." and ".." and skipping those entries (also MFC and Qt, etc. have nice directory handling classes, but I think you want to do it this way).
My modification:
do
{
// I added this - guess I can't embolden code text
if (wcscmp(file.cFileName,L".") == 0 || wcscmp(file.cFileName,L"..")==0)
continue;
p = PathCreator(dir,file.cFileName);
if(!is_directory(p))
{
std::wcout << p << std::endl;
}
else
{
GetAllFiles(p);
}
delete [] p;
}
while(FindNextFile(search_hendle, &file));
Again you try to use C in place of C++ and you still using wcout?! no problem you are a programmer and I'm sure you have a reason for this! but memory management in C is much much harder than C++ and you should have some skills to use it. Here is a fully working code but as you see it is really harder to manage, use and understand than its C++ version using standard containers and string, so if you are allowed to use C++(as you use wcout) then use its C++ version for ease:
#include <Windows.h>
/*! \brief Merge \a folder and \a filename into a newly allocate memory and
* return it to the caller. Use free to free returned memory!
*/
wchar_t* PathCreator( wchar_t const* folder, wchar_t const* filename )
{
wchar_t* res;
size_t i, len, folderLen = wcslen( folder ), filenameLen = wcslen( filename );
len = folderLen + filenameLen;
if( folder[folderLen - 1] != '\\' ) ++len;
++len; // for \0
res = (wchar_t*) malloc( sizeof(wchar_t) * len );
if( !res ) return NULL;
wcscpy_s( res, len, folder );
/* Remove possible wide card at end of folder */
for( i = folderLen; i--; ) {
if( res[i] == '*' || res[i] == '?' ) {
res[i] = 0;
--folderLen;
} else {
break;
}
}
if( res[folderLen - 1] != '\\' ) wcscat_s( res, len, L"\\" );
wcscat_s( res, len, filename );
return res;
}
/*! \brief Free memory that returned by \ref GetAllFiles
*/
void FreeAllFilesMemory( wchar_t** p )
{
wchar_t** tmp = p;
if( !p ) return ;
while( *tmp ) free( *tmp++ );
free( p );
}
wchar_t** AddToArray( wchar_t** p, size_t* pAllocated, size_t* pUsed, wchar_t* s )
{
if( *pUsed >= *pAllocated ) {
size_t newAlloc = *pAllocated * 3 / 2; // Grow by 1.5
if( newAlloc < 16 ) newAlloc = 16;
p = (wchar_t**) realloc( p, newAlloc * sizeof(wchar_t*) );
if( !p ) return NULL;
*pAllocated = newAlloc;
}
p[*pUsed] = s;
++*pUsed;
return p;
}
wchar_t** GetAllFilesImpl( wchar_t const* folder, wchar_t** res, size_t* pAllocated, size_t* pUsed )
{
HANDLE hSearch;
WIN32_FIND_DATAW fileinfo;
size_t allocatedMemory = 0;
hSearch = FindFirstFileW( folder, &fileinfo );
if( hSearch != INVALID_HANDLE_VALUE ) {
do {
wchar_t* sFileName, ** tmp, sTmp[ 1024 ];
/* ignore ., .. */
if( !wcscmp(fileinfo.cFileName, L".") ||
!wcscmp(fileinfo.cFileName, L"..") )
continue;
sFileName = PathCreator( folder, fileinfo.cFileName );
wprintf( L"%s\n", sFileName ); /* Print result */
tmp = AddToArray( res, pAllocated, pUsed, sFileName );
if( !tmp ) return FreeAllFilesMemory(res), NULL;
res = tmp;
if( fileinfo.dwFileAttributes & FILE_ATTRIBUTE_DIRECTORY ) {
wcscpy_s( sTmp, sFileName );
wcscat_s( sTmp, L"\\*" );
tmp = GetAllFilesImpl( sTmp, res, pAllocated, pUsed );
if( !tmp ) return NULL;
res = tmp;
}
} while( FindNextFileW(hSearch, &fileinfo) );
FindClose( hSearch );
}
return res;
}
/*! \brief List all files that match a pattern and return it as an array of
* wide strings, free result using \ref FreeAllFilesMemory
*/
wchar_t** GetAllFiles( wchar_t const* folder )
{
size_t nAllocated = 0, nUsed = 0;
wchar_t** res = GetAllFilesImpl( folder, NULL, &nAllocated, &nUsed );
if( res ) {
/* to indicate end of result add a NULL string */
wchar_t** tmp = AddToArray( res, &nAllocated, &nUsed, NULL );
if( !tmp ) return FreeAllFilesMemory(res), NULL;
res = tmp;
}
return res;
}
Related
I'm trying to use miniunzip to extract some files. It works on Linux. On Windows, it throws no errors, but if the file is executable, the resulting binary doesn't work. I get a message window with a message about incompatibility with 64-bit Windows. If I use another utility, such as 7-zip, to unpack it, everything works fine, so the problem is here in my code. Here is the class method that does all the work.
bool FileHandler::unzip( string inputFile, string outputDirectory )
{
if (!fileExists(inputFile)) {
this->errorMessage = "Can't find file at " + inputFile;
return false;
}
unzFile zipFile = unzOpen(inputFile.c_str());
if( zipFile == nullptr ){
this->errorMessage = "FileHandler::unzip failed to open input file";
return false;
}
vector<string> files;
vector<string> folders;
unz_global_info globalInfo;
int err = unzGetGlobalInfo( zipFile, &globalInfo );
if (unzGoToFirstFile(zipFile) != UNZ_OK) {
this->errorMessage = "FileHandler::unzip failed calling unzGoToFirstFile";
return false;
}
for ( unsigned long i=0; i < globalInfo.number_entry && err == UNZ_OK; i++ ){
char filename[FILENAME_MAX];
unz_file_info subFileInfo;
err = unzGetCurrentFileInfo( zipFile, &subFileInfo, filename,
sizeof(filename), NULL, 0, NULL, 0);
if ( err == UNZ_OK )
{
char nLast = filename[subFileInfo.size_filename-1];
if ( nLast =='/' || nLast == '\\' )
{
folders.push_back(filename);
}
else
{
files.push_back(filename);
}
err = unzGoToNextFile(zipFile);
}
}
for ( string & folder : folders ){
string strippedFolder = folder.substr(0, folder.length()-1);
string dirPath = normalizePath(outputDirectory+"/"+strippedFolder);
if( ! makeDirectory( dirPath ) ){
this->errorMessage = "FileHandler::unzip Failed to create directory "+dirPath;
return false;
}
}
for ( auto it = files.begin(); it != files.end(); it++ ){
if( zipFile == 0 ){
this->errorMessage = "FileHandler::unzip invalid unzFile object at position 1";
return false;
}
string filename = *it;
//string filepath = outputDirectory + "/" + *it;
string filepath = normalizePath( outputDirectory + "/" + *it );
const char * cFile = filename.c_str();
const char * cPath = filepath.c_str();
int err = unzLocateFile( zipFile, cFile, 0 );
if ( err != UNZ_OK ){
this->errorMessage = "FileHandler::unzip error locating sub-file.";
return false;
}
err = unzOpenCurrentFile( zipFile );
if( err != UNZ_OK ){
this->errorMessage = "FileHandler::unzip error opening current file";
return false;
}
ofstream fileStream{ cPath };
// Need an ostream object here.
if( fileStream.fail() ){
this->errorMessage = "FileHandler::unzip error opening file stream at "+string(cPath);
return false;
}
unz_file_info curFileInfo;
err = unzGetCurrentFileInfo( zipFile, &curFileInfo, 0, 0, 0, 0, 0, 0);
if ( err != UNZ_OK )
{
this->errorMessage = "FileHandler::unzip failed to read size of file";
return false;
}
unsigned int size = (unsigned int)curFileInfo.uncompressed_size;
char * buf = new char[size];
size = unzReadCurrentFile( zipFile, buf, size );
if ( size < 0 ){
this->errorMessage = "FileHandler::unzip unzReadCurrentFile returned an error. ";
return false;
}
fileStream.write( buf, size );
fileStream.flush();
delete [] buf;
fileStream.close();
#ifndef _WIN32
vector<string> parts = splitString(filename, ".");
if( parts.size() == 1 ){ // In linux, assume file without extension is executable
mode_t old_mask = umask( 000 );
chmod( cPath, S_IRWXU|S_IRWXG|S_IROTH|S_IXOTH );
umask( old_mask );
}
#endif
unzCloseCurrentFile( zipFile );
}
unzClose(zipFile);
return true;
}
std::ostream opens files in text mode by default, you need to make it use binary mode instead.
On Linux there doesn't seem to be any difference between text and binary modes. But on Windows, attempting to write \n into a text file produces \r\n, currupting your data.
You need to change this line
ofstream fileStream{ cPath };
to
ofstream fileStream{ cPath, ostream::out | ostream::binary };
Problem
I'm trying to get the volume id from a physical drive.
My Code
// define disk handle
HANDLE VDHANDLE;
// set "open disk" parameters
OPEN_VIRTUAL_DISK_PARAMETERS VHD_OPEN_PARAM;
VHD_OPEN_PARAM.Version = OPEN_VIRTUAL_DISK_VERSION_1;
VHD_OPEN_PARAM.Version1.RWDepth = OPEN_VIRTUAL_DISK_RW_DEPTH_DEFAULT;
// set storage type
VIRTUAL_STORAGE_TYPE VHD_STORAGE;
VHD_STORAGE.DeviceId = VIRTUAL_STORAGE_TYPE_DEVICE_VHD;
VHD_STORAGE.VendorId = VIRTUAL_STORAGE_TYPE_VENDOR_MICROSOFT;
// set "attach disk" parameters
ATTACH_VIRTUAL_DISK_PARAMETERS VHD_ATTACH_PARAM;
VHD_ATTACH_PARAM.Version = ATTACH_VIRTUAL_DISK_VERSION_1;
// open disk
if ( OpenVirtualDisk( &VHD_STORAGE, L"F:\\MyStorageBunker.vhd",
VIRTUAL_DISK_ACCESS_ALL, OPEN_VIRTUAL_DISK_FLAG_NONE,
&VHD_OPEN_PARAM, &VDHANDLE ) != ERROR_SUCCESS )
{
return ERR_MOUNT_SCRIPTCREATE;
}
// attach drive
if ( AttachVirtualDisk( VDHANDLE, 0, ATTACH_VIRTUAL_DISK_FLAG_PERMANENT_LIFETIME,
0, &VHD_ATTACH_PARAM, 0 ) != ERROR_SUCCESS )
{
return ERR_MOUNT_SCRIPTEXECUTE;
}
// Get attached drive & info
wchar_t DriveInfo[ MAX_PATH ];
ULONG bufferSize = sizeof( DriveInfo );
GetVirtualDiskPhysicalPath( VDHANDLE, &bufferSize, DriveInfo );
// DriveInfo raw output = \PHYSICALDISKX
// X = volume id
What I tried
std::wstringstream tmp;
int value;
char c;
std::wstringstream ss( DriveInfo );
ss >> tmp >> c >> value;
Issue
no operator ">>" matches these operands
Questions
How can I extract the volume id from wchar_t DriveInfo?
Is there any way to get the volume id except GetVirtualDiskPhysicalPath?
I cribbed this code from somewhere I can't recall, but it seems to work for getting the serial# from the first valid drive. Sorry if it doesn't compile, I had to replace our own string class with the general one. The thing you probably want out of this is the call to GetVolumeInformation()
template <class ELT> static const ELT* NextToken(const ELT* ptr) {
// Skip this null-terminated string
while (*ptr != 0) {
ptr++;
}
ptr++;
return ptr;
}
int getDiskId() {
int bufSize = GetLogicalDriveStrings(0, 0);
WCHAR* buffer = new WCHAR[bufSize];
GetLogicalDriveStrings(bufSize, buffer);
std::vector<std::string> driveStrings;
for (const WCHAR *ptr = buffer; *ptr != 0; ptr = NextToken(ptr)) {
if (toupper(*ptr) == 'A' || toupper(*ptr) == 'B') {
continue;
}
std::string tmp;
tmp += toupper(*ptr);
driveStrings.push_back(tmp);
}
// want lowest letter first
std::sort(driveStrings.begin(), driveStrings.end());
for (int i = 0; i < driveStrings.size(); i++) {
DWORD dummy(0);
DWORD serialNumber(0);
if (
GetVolumeInformation(
driveStrings[i].c_str(), // lpRootPathName
0, // lpVolumeNameBuffer
0, // nVolumeNameSize
&serialNumber,
&dummy, // lpMaximumComponentLength
&dummy, // lpFileSystemFlags
0, // lpFileSystemNameBuffer
0 // nFileSystemNameSize
)
) {
break;
}
}
delete [] buffer;
return serialNumber;
}
I'm trying to use FP routine, but it doesn't work...Why?
This is my code:
int output = FindPattern(0x0042A000, 0x2000, "\x68\x00\x00\x00\x00\xFF\x76\x08\x89\x46\x44", "x????xxxxxx");
if (output > -1) {
ReadProcessMemory(hProcHandle, (PVOID)address, &value2, sizeof(value2), NULL);
}
Function:
int FindPattern(int start_offset, int size, const char * pattern, const char * mask)
{
int pos = 0;
for (int retAddress = start_offset; retAddress < start_offset + size; retAddress++)
{
if (*(const char*)retAddress == pattern[pos] || mask[pos] == '?')
{
if (mask[pos+1] == '\0')
return retAddress+1;
pos++;
}
else
pos = 0;
}
return -1;
}
I also tried:
DWORD output = FindPattern(hProcHandle, "\x68\x00\x00\x00\x00\xFF\x76\x08\x89\x46\x44", "x????xxxxxx");
bool VerifyAddress(HANDLE hwnd, DWORD dwAddress, char *bMask, char *szMask )
{
PBYTE *pTemp = { 0 };
for ( int i = 0; *szMask; ++szMask, ++bMask, ++i )
{
if ( !ReadProcessMemory( hwnd, reinterpret_cast<LPCVOID>(dwAddress + i), &pTemp, sizeof(pTemp), 0 ) ){
return false;
}
if ( *szMask == 'x' && (char)pTemp != *bMask){
return false;
}
}
return true;
}
DWORD FindPattern(HANDLE hwnd, char* bMask, char *szMask )
{
for ( DWORD dwCurrentAddress = 0x4FFFFFF; dwCurrentAddress < 0x7FFFFFF; dwCurrentAddress++ ){
if ( VerifyAddress( hwnd, dwCurrentAddress, bMask, szMask )) {
return dwCurrentAddress;
}
}
But with these codes I get always
Unhandled exception at 0x01034BB1 in Program.exe: 0xC0000005: Access
violation reading location 0x02343DA2.
This code:
int output = FindPattern(0x0042A000, 0x2000,
indicates that you are using address 0x0042A000 local to your process, so you are iterating over some random addresses in your process which is Undefined Behaviour and ends with exception.
ReadProcessMemory copies specified memory from some other process to your process and stores in in memory buffer you provide in this function call as lpBuffer parameter.
I compiled a Linux program on Windows via Mingw but the output is wrong.
Error description:
The output of the program looks different on Windows than on Linux. This is how it looks on Windows:
>tig_2
CAATCTTCAGAGTCCAGAGTGGGAGGCACAGACTACAGAAAATGAGCAGCGGGGCTGGTA
>cluster_1001_conTTGGTGAAGAGAATTTGGACATGGATGAAGGCTTGGGCTTGACCATGCGAAGG
Expected output:
>cluster_1001_contig2
CAATCTTCAGAGTCCAGAGTGGGAGGCACAGACTACAGAAAATGAGCAGCGGGGCTGGTA
>cluster_1001_contig1
TTGGTGAAGAGAATTTGGACATGGATGAAGGCTTGGGCTTGACCATGCGAAGG
(Note: the output is very large to paste it here so the examples above are pseudo-real).
Possible cause:
I have observed that if I convert the enter characters the input file from Linux (LF) to Windows (CRLF) it almost works: the first character (>) in file is missing. The same code works perfectly on Linux without any enter conversion. So, the problem must be in the function that is parsing the input not in the one that writes the output:
seq_db.Read( db_in.c_str(), options );
Source code:
This is the piece that is parsing the input file. Anyway, I might me wrong. The fault might be in other place. In case it is needed, the FULL source code is here :)
void SequenceDB::Read( const char *file, const Options & options )
{
Sequence one;
Sequence dummy;
Sequence des;
Sequence *last = NULL;
FILE *swap = NULL;
FILE *fin = fopen( file, "r" );
char *buffer = NULL;
char *res = NULL;
size_t swap_size = 0;
int option_l = options.min_length;
if( fin == NULL ) bomb_error( "Failed to open the database file" );
if( options.store_disk ) swap = OpenTempFile( temp_dir );
Clear();
dummy.swap = swap;
buffer = new char[ MAX_LINE_SIZE+1 ];
while (not feof( fin ) || one.size) { /* do not break when the last sequence is not handled */
buffer[0] = '>';
if ( (res=fgets( buffer, MAX_LINE_SIZE, fin )) == NULL && one.size == 0) break;
if( buffer[0] == '+' ){
int len = strlen( buffer );
int len2 = len;
while( len2 && buffer[len2-1] != '\n' ){
if ( (res=fgets( buffer, MAX_LINE_SIZE, fin )) == NULL ) break;
len2 = strlen( buffer );
len += len2;
}
one.des_length2 = len;
dummy.des_length2 = len;
fseek( fin, one.size, SEEK_CUR );
}else if (buffer[0] == '>' || buffer[0] == '#' || (res==NULL && one.size)) {
if ( one.size ) { // write previous record
one.dat_length = dummy.dat_length = one.size;
if( one.identifier == NULL || one.Format() ){
printf( "Warning: from file \"%s\",\n", file );
printf( "Discarding invalid sequence or sequence without identifier and description!\n\n" );
if( one.identifier ) printf( "%s\n", one.identifier );
printf( "%s\n", one.data );
one.size = 0;
}
one.index = dummy.index = sequences.size();
if( one.size > option_l ) {
if ( swap ) {
swap_size += one.size;
// so that size of file < MAX_BIN_SWAP about 2GB
if ( swap_size >= MAX_BIN_SWAP) {
dummy.swap = swap = OpenTempFile( temp_dir );
swap_size = one.size;
}
dummy.size = one.size;
dummy.offset = ftell( swap );
dummy.des_length = one.des_length;
sequences.Append( new Sequence( dummy ) );
one.ConvertBases();
fwrite( one.data, 1, one.size, swap );
}else{
//printf( "==================\n" );
sequences.Append( new Sequence( one ) );
//printf( "------------------\n" );
//if( sequences.size() > 10 ) break;
}
//if( sequences.size() >= 10000 ) break;
}
}
one.size = 0;
one.des_length2 = 0;
int len = strlen( buffer );
int len2 = len;
des.size = 0;
des += buffer;
while( len2 && buffer[len2-1] != '\n' ){
if ( (res=fgets( buffer, MAX_LINE_SIZE, fin )) == NULL ) break;
des += buffer;
len2 = strlen( buffer );
len += len2;
}
size_t offset = ftell( fin );
one.des_begin = dummy.des_begin = offset - len;
one.des_length = dummy.des_length = len;
int i = 0;
if( des.data[i] == '>' || des.data[i] == '#' || des.data[i] == '+' ) i += 1;
if( des.data[i] == ' ' or des.data[i] == '\t' ) i += 1;
if( options.des_len and options.des_len < des.size ) des.size = options.des_len;
while( i < des.size and ( des.data[i] != '\n') ) i += 1;
des.data[i] = 0;
one.identifier = dummy.identifier = des.data;
} else {
one += buffer;
}
}
#if 0
int i, n = 0;
for(i=0; i<sequences.size(); i++) n += sequences[i].bufsize + 4;
cout<<n<<"\t"<<sequences.capacity() * sizeof(Sequence)<<endl;
int i;
scanf( "%i", & i );
#endif
one.identifier = dummy.identifier = NULL;
delete[] buffer;
fclose( fin );
}
The format of the input file is like this:
> comment
ACGTACGTACGTACGTACGTACGTACGTACGT
> comment
ACGTACGTACGTACGTACGTACGTACGTACGT
> comment
ACGTACGTACGTACGTACGTACGTACGTACGT
etc
The issue is more than likely you need to open the file using the "rb" switch in the call to fopen. The "rb" opens the file in binary mode, as opposed to "r", which opens a file in "text" mode.
Since you're going back and forth between Linux and Windows, the end-of-line characters will be different. If you open the file as "text" in Windows, but the file was formatted for Linux, you're lying to Windows that it is a text file. So the runtime will do CR/LF conversion all wrong.
Therefore you should open the file as binary, "rb" so that the CR/LF translation isn't done.
I have a visual c++ project file (vcproj) and i want to programmatically modify it in order to add additional include directories or link libraries.
One solution could be to parse the vcproj as an XML file and modify it. There is any other API to make this easier?
Here is some code I wrote for fetching from a Visual Studio solution (.sln) all the projects it contains, and from each project, all the file (including full paths) it contain.
static strList parseSolution( const char * solName )
{
strList result;
static char drive[_MAX_DRIVE];
static char somepath[_MAX_PATH];
static char buffer[_MAX_PATH];
static char path[_MAX_PATH];
static char ext[_MAX_EXT];
_splitpath( solName, drive, somepath, buffer, ext );
FILE * f = fopen( solName, "r" );
if( NULL == f )
{
printf("ERROR: Solution %s is missing or unavailable.\n", solName );
exit(1);
}
while( !feof(f) )
{
char * res = fgets( buffer, sizeof(buffer), f );
if( NULL == res )
continue;
if( NULL != strstr(buffer, "Project(") )
{
char * ptrName = strchr( buffer, '=' );
char * ptrFile = strchr( ptrName, ',' );
*ptrFile++ = 0;
char * ptrEnd = strchr( ptrFile, ',' );
*ptrEnd++ = 0;
while( ('=' == *ptrName)
||(' ' == *ptrName)
||('"' == *ptrName) ) ptrName++;
if( '"' == ptrName[strlen(ptrName)-1] )
ptrName[strlen(ptrName)-1] = 0;
while( (' ' == *ptrFile)
||('"' == *ptrFile) ) ptrFile++;
if( '"' == ptrFile[strlen(ptrFile)-1] )
ptrFile[strlen(ptrFile)-1] = 0;
_makepath( path, drive, somepath, ptrFile, NULL );
result.push_back( std::string(path) );
}
}
fclose(f);
return result;
}
/**
* Parse project and extract fullpath source filename from project.
*/
static strList parseProject( const char * projName )
{
strList result;
static char drive[_MAX_DRIVE];
static char somepath[_MAX_PATH];
static char buffer[_MAX_PATH];
static char path[_MAX_PATH];
static char ext[_MAX_EXT];
_splitpath( projName, drive, somepath, buffer, ext );
FILE * f = fopen( projName, "r" );
if( NULL == f )
{
printf("ERROR: Project %s is missing or unavailable.\n", projName );
exit(1);
}
while( !feof(f) )
{
char * res = fgets( buffer, sizeof(buffer), f );
if( NULL == res )
continue;
if( (NULL != strstr(buffer, "<ClInclude Include="))
||(NULL != strstr(buffer, "<ClCompile Include=")) )
{
char * ptrName = strchr( buffer, '=' );
char * ptrName1 = strstr( buffer, "/>" );
if( NULL != ptrName1 ) *ptrName1 = 0;
while( ('=' == *ptrName)
||(' ' == *ptrName)
||('"' == *ptrName) ) ptrName++;
while( ('"' == ptrName[strlen(ptrName)-1])
||(' ' == ptrName[strlen(ptrName)-1])
||('\n' == ptrName[strlen(ptrName)-1]))
ptrName[strlen(ptrName)-1] = 0;
_makepath( path, drive, somepath, ptrName, NULL );
result.push_back( std::string(path) );
}
}
fclose(f);
return result;
}
/**
* Recoding source file.
*/
Using these functions you can work on each file, or work on the projects themselves.
strList projectList = parseSolution( argv[1] );
strList::iterator itProj = projectList.begin();
while( itProj != projectList.end() )
{
printf("Project: %s\n", itProj->c_str());
strList fileName = parseProject( itProj->c_str() );
strList::iterator itFile = fileName.begin();
while( itFile != fileName.end() )
{
printf(" File %s\n", itFile->c_str());
// do something with the project file
itFile++;
}
fileName.clear();
itProj++;
}