I'm trying to extract a sentence from a long string using Ruby.
Example:
Hi There the file is in this directory: /Volumes/GAW-FS01/08_Video/02_Projects/ Plus/S/metadata.xml Thank you for your inquiry.
It should return: /Volumes/GAW-FS01/08_Video/02_Projects/ Plus/S/metadata.xml
The beginning always include "/Volume" and it has ti end with ".xml"
Thank you
You're probably looking for this -
long_string = <<file
Hi There the file is in this directory: /Volumes/GAW-FS01/08_Video/02_Projects/Plus/S/metadata.xml Thank you for your inquiry.Hi There the file is in this directory: /Volumes/GAW-def/08_Video/02_Projects/Plus/S/metadata.xml Thank you for your inquiry.Hi There the file is in this directory: /Volumes/GAW-FS01/08_Video/02_Projects/hello/S/metadata.xml Thank you for your inquiry.
file
long_string.split.select{ |word| word.starts_with?("/Volumes") && word.end_with?(".xml") }
It'll give you array of paths which match your condition like follow -
["/Volumes/GAW-FS01/08_Video/02_Projects/Plus/S/metadata.xml", "/Volumes/GAW-def/08_Video/02_Projects/Plus/S/metadata.xml", "/Volumes/GAW-FS01/08_Video/02_Projects/hello/S/metadata.xml"]
There are many ways to do this.
string = "Hi There the file is in this directory: /Volumes/GAW-FS01/08_Video/02_Projects/ Plus/S/metadata.xml Thank you for your inquiry."
Funky:
"Volume#{string[/Volume(.*?).xml/, 1]}.xml"
Funkier, find the index of the strings and use the range to return the desired string
first = "Volume"
last = ".xml"
string[(string.index(first)) .. (string.index(last) + last.length)]
=> "Volumes/GAW-FS01/08_Video/02_Projects/ Plus/S/metadata.xml "
Not so funky, split the string by the start and end points and return the desired string
"Volume#{string.split('Volume').last.split('.xml').first}.xml"
=> "Volumes/GAW-FS01/08_Video/02_Projects/ Plus/S/metadata.xml"
Lastly, the way you'd probably want to do this
string[/Volume(.*?).xml/, 0]
=> "Volumes/GAW-FS01/08_Video/02_Projects/ Plus/S/metadata.xml"
You notice the first and last options are the same, despite the int passed changing between 0 and 1. The 0 captures the regular expressions used to match where the 1 does not.
Related
I am trying to extract a dynamic value (static characters) from a csv file in a specific column and output the value to another csv.
The data element I am trying to extract is '12385730561818101591' from the value 'callback=B~12385730561818101591' located in a specific column.
I have written the below python script, but the output results are always blank. The regex '=(~[0-9]+)' was validated to successfully pull out the '12385730561818101591' value. This was tested on www.regex101.com.
When I use this in Python, no results are displayed in the output file. I have a feeling the '~' is causing the error. When I tried searching for '~' in the original CSV file, no results were found, but it is there!
Can the community help me with the following:
(1) Determine root cause of no output and validate if '~' is the problem. Could the problem also be the way I'm splitting the rows? I'm not sure if the rows should be split by ';' instead of ','.
import csv
import sys
import ast
import re
filename1 = open("example.csv", "w")
with open('example1.csv') as csvfile:
data = None
patterns = '=(~[0-9]+)'
data1= csv.reader(csvfile)
for row in data1:
var1 = row[57]
for item in var1.split(','):
if re.search(patterns, item):
for data in item:
if 'common' in data:
filename1.write(data + '\n')
filename1.close()
Here I have tried to write sample code. Hope this will help you in solving the problem:
import re
str="callback=B~12385730561818101591"
rc=re.match(r'.*=B\~([0-9A-Ba-b]+)', str)
print rc.group(1)
You regex is wrong for your example :
=(~[0-9]+) will never match callback=B~12385730561818101591 because of the B after the = and before the ~.
Also you include the ~ in the capturing group.
Not exatly sure what's your goal but this could work. Give more details if you have more restrictions.
=.+~([0-9]+)
EDIT
Following the new provided information :
patterns = '=.+~([0-9]+)'
...
result = re.search(patterns, item):
number = result.group(0)
filename1.write(number + '\n')
...
Concerning your line split on the \t (tabulation) you should show an example of the full line
Task: To find all the numbers in a text file and compute the sum of it.
Link to file(if required) : http://python-data.dr-chuck.net/regex_sum_42.txt
name = raw_input("Enter your file: ")
if len(name) < 1: name = "sample.txt"
try:
open(name)
except:
print "Please enter a valid file name."
exit()
import re
lst = list()
for line in name:
line = line.strip() #strip() instead of rstrip() as there were space before line as well
stuff = re.findall("[0-9]+", line)
print stuff # i tried to trace back and realize it prints empty list so problem should be here
stuff = int(stuff[0]) # i think this is wrong as well
lst.append(stuff)
sum(lst)
print sum(lst)
Can someone tell me where did I go wrong ? sorry for any formatting errors and thanks for the help
I have also tried:
\s[0-9]+\s
.[0-9]+.
You need to change your code to:
lst = []
with open(name) as f:
for line in f:
stuff = [lst.append(int(x)) for x in re.findall("[0-9]+", line.strip())]
print sum(lst)
See the IDEONE demo
The problem was that you tried to parse an empty string in the first place. When parsing to int and appending to the list (declared with lst = []) inside comprehension, you avoid messing with empty output and the list you get is flattened automatically.
Also, you need to actually read the file in. "The with statement handles opening and closing the file, including if an exception is raised in the inner block. The for line in f treats the file object f as an iterable, which automatically uses buffered IO and memory management so you don't have to worry about large files." (source)
I’m trying to use a Python Regular Expression to extract a genome sequence from a genome database; I’ve pasted a snippet of the database below.
>GSVIVT01031739001 pacid=17837850 polypeptide=GSVIVT01031739001 locus=GSVIVG01031739001 ID=GSVIVT01031739001.Genoscope12X annot-version=Genoscope.12X ATGAAAACGGAACTCTTTCTAGGTCATTTCCTCTTCAAACAAGAAAGAAGTAAAAGTTGCATACCAAATATGGACTCGAT TTGGAGTCGTAGTGCCCTGTCCACAGCTTCGGACTTCCTCACTGCAATCTACTTCGCCTTCATCTTCATCGTCGCCAGGT TTTTCTTGGACAGATTCATCTATCGAAGGTTGGCCATCTGGTTATTGAGCAAGGGAGCTGTTCCATTGAAGAAAAATGAT GCTACACTGGGAAAAATTGTAAAATGTTCGGAGTCTTTGTGGAAACTAACATACTATGCAACTGTTGAAGCATTCATTCT TGCTATTTCCTACCAAGAGCCATGGTTTAGAGATTCAAAGCAGTACTTTAGAGGGTGGCCAAATCAAGAGTTGACGCTTC CCCTCAAGCTTTTCTACATGTGCCAATGTGGGTTCTACATCTACAGCATTGCTGCCCTTCTTACATGGGAAACTCGCAGG AGGGATTTCTCTGTGATGATGTCTCATCATGTAGTCACTGTTATCCTAATTGGGTACTCATACATATCAAGTTTTGTCCG GATCGGCTCAGTTGTCCTTGCCCTGCACGATGCAAGTGATGTCTTCATGGAAGCTGCAAAAGTTTTTAAATATTCTGAGA AGGAGCTTGCAGCAAGTGTGTGCTTTGGATTTTTTGCCATCTCATGGCTTGTCCTACGGTTAATATTCTTTCCCTTTTGG GTTATCAGTGCATCAAGCTATGATATGCAAAATTGCATGAATCTATCGGAGGCCTATCCCATGTTGCTATACTATGTTTT CAATACAATGCTCTTGACACTACTTGTGTTCCATATATACTGGTGGATTCTTATATGCTCAATGATTATGAGACAGCTGA AAAATAGAGGACAAGTTGGAGAAGATATAAGATCTGATTCAGAGGACGATGAATAG
>GSVIVT01031740001 pacid=17837851 polypeptide=GSVIVT01031740001 locus=GSVIVG01031740001 ID=GSVIVT01031740001.Genoscope12X annot-version=Genoscope.12X ATGGGTATTACTACTTCCCTCTCATATCTTTTATTCTTCAACATCATCCTCCCAACCTTAACGGCTTCTCCAATACTGTT TCAGGGGTTCAATTGGGAATCATCCAAAAAGCAAGGAGGGTGGTACAACTTCCTCATCAACTCCATTCCTGAACTATCTG CCTCTGGAATCACTCATGTTTGGCTTCCTCCACCCTCTCAGTCTGCTGCATCTGAAGGGTACCTGCCAGGAAGGCTTTAT GATCTCAATGCATCCCACTATGGTACCCAATATGAACTAAAAGCATTGATAAAGGCATTTCGCAGCAATGGGATCCAGTG CATAGCAGACATAGTTATAAACCACAGGACTGCTGAGAAGAAAGATTCAAGAGGAATATGGGCCATCTTTGAAGGAGGAA CCCCAGATGATCGCCTTGACTGGGGTCCATCTTTTATCTGCAGTGATGACACTCTTTTTTCTGATGGCACAGGAAATCCT GATACTGGAGCAGGCTTCGATCCTGCTCCAGACATTGATCATGTAAACCCCCGGGTCCAGCGAGAGCTATCAGATTGGAT GAATTGGTTAAAGATTGAAATAGGCTTTGCTGGATGGCGATTCGATTTTGCTAGAGGATACTCCCCAGATTTTACCAAGT TGTATATGGAAAACACTTCGCCAAACTTTGCAGTAGGGGAAATATGGAATTCTCTTTCTTATGGAAATGACAGTAAGCCA AACTACAACCAAGATGCTCATCGGCGTGAGCTTGTGGACTGGGTGAAAGCTGCTGGAGGAGCAGTGACTGCATTTGATTT TACAACCAAAGGGATACTCCAAGCTGCAGTGGAAGGGGAATTGTGGAGGCTGAAGGACTCAAATGGAGGGCCTCCAGGAA TGATTGGCTTAATGCCTGAAAATGCTGTGACTTTCATAGATAATCATGACACAGGTTCTACACAAAAAATTTGGCCATTC CCATCAGACAAAGTCATGCAGGGATATGTTTATATCCTCACTCATCCTGGGATTCCATCCATATTCTATGACCACTTCTT TGACTGGGGTCTGAAGGAGGAGATTTCTAAGCTGATCAGTATCAGGACCAGGAACGGGATCAAACCCAACAGTGTGGTGC GTATTCTGGCATCTGACCCAGATCTTTATGTAGCTGCCATAGATGAGAAAATCATTGCTAAGATTGGACCAAGGTATGAT GTTGGGAACCTTGTACCTTCAACCTTCAAACTTGCCACCTCTGGCAACAATTATGCTGTGTGGGAGAAACAGTAA
>GSVIVT01031741001 pacid=17837852 polypeptide=GSVIVT01031741001 locus=GSVIVG01031741001 ID=GSVIVT01031741001.Genoscope12X annot-version=Genoscope.12X ATGTCCAAATTAACTTATTTATTATCTCGGTACATGCCAGGAAGGCTTTATGATCTGAATGCATCCAAATATGGCACCCA AGATGAACTGAAAACACTGATAAAGGTGTTTCACAGCAAGGGGGTCCAGTGCATAGCAGACATAGTTATAAACCACAGAA CTGCAGAGAAGCAAGACGCAAGAGGAATATGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGACCCCAT CTTTCCTTTGCAAGGACGACACTCCTTATTCCGACGGCACCGGAAACCCTGATTCTGGAGATGACTACAGTGCCGCACCA GACATCGACCACATCAACCCACGGGTTCAGCAAGAGCTAA
What I’m trying to do is get the genome (ACGT) sequence for GSVIV01031740001 (the middle sequence), and none of the others. My current regex is
sequence = re.compile('(?<=>GSVIVT01031740001) pacid=.*annot-version=.*\n[ACGT\n]*[^(?<!>GSVIVT01031740001) pacid]’)
with my logic being find the header with the genbank ID for the correct organism, give me that line, then go to a new line and give me all ACGT and new lines until I get to a header for an organism with a different genbank ID. This fails to give any results.
Yes, I know that re.compile doesn’t actually perform a search; I’m searching against a file opened as ‘target’ so my execution looks like
>>> for nucl in target:
... if re.search(sequence, nucl):
... print(nucl)
Can someone tell me what I’m doing wrong, either in my regex or by using regex in the first place? When I try this on regex101.com, it works, but when I try it in the Python interpreter (2.7.1), it fails.
Thanks!
If I understand correctly , you want JUST the genomic sequence for a given locus. So You can do something like this.(assumes your data is in a file)
lines = [line.split(' ') for line in open('results.txt') ]
somedict = {}
for each in lines:
locus = each[3].split('=')[-1]
seq = ''.join(each[6:])
somedict[locus] = seq
print somedict
It outputs a dictionary with the locus as key and sequence as value
{'GSVIVG01031741001': 'ATGTCCAAATTAACTTATTTATTATCTCGGTACATGCCAGGAAGGCTTTATGATCTGAATGCATCCAAATATGGCACCCAAGATGAACTGAAAACACTGATAAAGGTGTTTCACAGCAAGGGGGTCCAGTGCATAGCAGACATAGTTATAAACCACAGAACTGCAGAGAAGCAAGACGCAAGAGGAATATGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGACCCCATCTTTCCTTTGCAAGGACGACACTCCTTATTCCGACGGCACCGGAAACCCTGATTCTGGAGATGACTACAGTGCCGCACCAGACATCGACCACATCAACCCACGGGTTCAGCAAGAGCTAA\n', 'GSVIVG01031740001': 'ATGGGTATTACTACTTCCCTCTCATATCTTTTATTCTTCAACATCATCCTCCCAACCTTAACGGCTTCTCCAATACTGTTTCAGGGGTTCAATTGGGAATCATCCAAAAAGCAAGGAGGGTGGTACAACTTCCTCATCAACTCCATTCCTGAACTATCTGCCTCTGGAATCACTCATGTTTGGCTTCCTCCACCCTCTCAGTCTGCTGCATCTGAAGGGTACCTGCCAGGAAGGCTTTATGATCTCAATGCATCCCACTATGGTACCCAATATGAACTAAAAGCATTGATAAAGGCATTTCGCAGCAATGGGATCCAGTGCATAGCAGACATAGTTATAAACCACAGGACTGCTGAGAAGAAAGATTCAAGAGGAATATGGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGGGTCCATCTTTTATCTGCAGTGATGACACTCTTTTTTCTGATGGCACAGGAAATCCTGATACTGGAGCAGGCTTCGATCCTGCTCCAGACATTGATCATGTAAACCCCCGGGTCCAGCGAGAGCTATCAGATTGGATGAATTGGTTAAAGATTGAAATAGGCTTTGCTGGATGGCGATTCGATTTTGCTAGAGGATACTCCCCAGATTTTACCAAGTTGTATATGGAAAACACTTCGCCAAACTTTGCAGTAGGGGAAATATGGAATTCTCTTTCTTATGGAAATGACAGTAAGCCAAACTACAACCAAGATGCTCATCGGCGTGAGCTTGTGGACTGGGTGAAAGCTGCTGGAGGAGCAGTGACTGCATTTGATTTTACAACCAAAGGGATACTCCAAGCTGCAGTGGAAGGGGAATTGTGGAGGCTGAAGGACTCAAATGGAGGGCCTCCAGGAATGATTGGCTTAATGCCTGAAAATGCTGTGACTTTCATAGATAATCATGACACAGGTTCTACACAAAAAATTTGGCCATTCCCATCAGACAAAGTCATGCAGGGATATGTTTATATCCTCACTCATCCTGGGATTCCATCCATATTCTATGACCACTTCTTTGACTGGGGTCTGAAGGAGGAGATTTCTAAGCTGATCAGTATCAGGACCAGGAACGGGATCAAACCCAACAGTGTGGTGCGTATTCTGGCATCTGACCCAGATCTTTATGTAGCTGCCATAGATGAGAAAATCATTGCTAAGATTGGACCAAGGTATGATGTTGGGAACCTTGTACCTTCAACCTTCAAACTTGCCACCTCTGGCAACAATTATGCTGTGTGGGAGAAACAGTAA\n', 'GSVIVG01031739001': 'ATGAAAACGGAACTCTTTCTAGGTCATTTCCTCTTCAAACAAGAAAGAAGTAAAAGTTGCATACCAAATATGGACTCGATTTGGAGTCGTAGTGCCCTGTCCACAGCTTCGGACTTCCTCACTGCAATCTACTTCGCCTTCATCTTCATCGTCGCCAGGTTTTTCTTGGACAGATTCATCTATCGAAGGTTGGCCATCTGGTTATTGAGCAAGGGAGCTGTTCCATTGAAGAAAAATGATGCTACACTGGGAAAAATTGTAAAATGTTCGGAGTCTTTGTGGAAACTAACATACTATGCAACTGTTGAAGCATTCATTCTTGCTATTTCCTACCAAGAGCCATGGTTTAGAGATTCAAAGCAGTACTTTAGAGGGTGGCCAAATCAAGAGTTGACGCTTCCCCTCAAGCTTTTCTACATGTGCCAATGTGGGTTCTACATCTACAGCATTGCTGCCCTTCTTACATGGGAAACTCGCAGGAGGGATTTCTCTGTGATGATGTCTCATCATGTAGTCACTGTTATCCTAATTGGGTACTCATACATATCAAGTTTTGTCCGGATCGGCTCAGTTGTCCTTGCCCTGCACGATGCAAGTGATGTCTTCATGGAAGCTGCAAAAGTTTTTAAATATTCTGAGAAGGAGCTTGCAGCAAGTGTGTGCTTTGGATTTTTTGCCATCTCATGGCTTGTCCTACGGTTAATATTCTTTCCCTTTTGGGTTATCAGTGCATCAAGCTATGATATGCAAAATTGCATGAATCTATCGGAGGCCTATCCCATGTTGCTATACTATGTTTTCAATACAATGCTCTTGACACTACTTGTGTTCCATATATACTGGTGGATTCTTATATGCTCAATGATTATGAGACAGCTGAAAAATAGAGGACAAGTTGGAGAAGATATAAGATCTGATTCAGAGGACGATGAATAG\n'}
I would like to retrieve the coding amino-acid when there is certain pattern in a DNA sequence. For example, the pattern could be: ATAGTA. So, when having:
Input file:
>sequence1
ATGGCGCATAGTAATGC
>sequence2
ATGATAGTAATGCGCGC
The ideal output would be a table having for each amino-acid the number of times is coded by the pattern. Here in sequence1, pattern codes only for one amino-acid, but in sequence2 it codes for two. I would like to have this tool working to scale to thousands of sequences. I've been thinking about how to get this done, but I only thought to: replace all nucleotides different than the pattern, translate what remains and get summary of the coded amino-acids.
Please let me know if this task can be performed by an already available tool.
Thanks for your help. All the best, Bernardo
Edit (due to the confusion generated with my post):
Please forget the original post and sequence1 and sequence2 too.
Hi all, and sorry for the confusion. The input fasta file is a *.ffn file derived from a GenBank file using 'FeatureExtract' tool (http://www.cbs.dtu.dk/services/FeatureExtract/download.php), so a can imagine they are already in frame (+1) and there is no need to get amino-acids coded in a frame different than +1.
I would like to know for which amino-acid the following sequences are coding for:
AGAGAG
GAGAGA
CTCTCT
TCTCTC
The unique strings I want to get coding amino-acids are repeats of three AG, GA, CT or TC, that is (AG)3, (GA)3, (CT)3 and (TC)3, respectively. I don't want the program to retrieve coding amino-acids for repeats of four or more.
Thanks again, Bernardo
Here's some code that should at least get you started. For example, you can run like:
./retrieve_coding_aa.pl file.fa ATAGTA
Contents of retrieve_coding_aa.pl:
#!/usr/bin/perl
use strict;
use warnings;
use File::Basename;
use Bio::SeqIO;
use Bio::Tools::CodonTable;
use Data::Dumper;
my $pattern = $ARGV[1];
my $fasta = Bio::SeqIO->new ( -file => $ARGV[0], -format => 'fasta');
while (my $seq = $fasta->next_seq ) {
my $pos = 0;
my %counts;
for (split /($pattern)/ => $seq->seq) {
if ($_ eq $pattern) {
my $dist = $pos % 3;
unless ($dist == 0) {
my $num = 3 - $dist;
s/.{$num}//;
chop until length () % 3 == 0;
}
my $table = Bio::Tools::CodonTable->new();
$counts{$_}++ for split (//, $table->translate($_));
}
$pos += length;
}
print $seq->display_id() . ":\n";
map {
print "$_ => $counts{$_}\n"
}
sort {
$counts{$a} <=> $counts{$b}
}
keys %counts;
print "\n";
}
Here are the results using the sample input:
sequence1:
S => 1
sequence2:
V => 1
I => 1
The Bio::Tools::CodonTable class also supports non-standard codon usage tables. You can change the table using the id pointer. For example:
$table = Bio::Tools::CodonTable->new( -id => 5 );
or:
$table->id(5);
For more information, including how to examine these tables, please see the documentation here: http://metacpan.org/pod/Bio::Tools::CodonTable
I will stick to that first version of what you wanted cause the addendum only confused me even more. (frame?)
I only found ATAGTA once in sequence2 but I assume you want the mirror images/reverse sequence as well, which would be ATGATA in this case. Well my script doesn't do that so you would have to write it up twice in the input_sequences file but that should be no problem I would think.
I work with a file like yours which I call "dna.txt" and a input sequences file called "input_seq.txt". The result file is a listing of patterns and their occurences in the dna.txt file (including overlap-results but it can be set to non-overlap as explained in the awk).
input_seq.txt:
GC
ATA
ATAGTA
ATGATA
dna.txt:
>sequence1
ATGGCGCATAGTAATGC
>sequence2
ATGATAGTAATGCGCGC
results.txt:
GC,6
ATA,2
ATAGTA,2
ATGATA,1
Code is awk calling another awk (but one of them is simple). You have to run
"./match_patterns.awk input_seq.txt" to get the results file generated.:
*match_patterns.awk:*
#! /bin/awk -f
{return_value= system("awk -vsubval="$1" -f test.awk dna.txt")}
test.awk:
#! /bin/awk -f
{string=$0
do
{
where = match(string, subval)
# code is for overlapping matches (i.e ATA matches twice in ATATAC)
# for non-overlapping replace +1 by +RLENGTH in following line
if (RSTART!=0){count++; string=substr(string,RSTART+1)}
}
while (RSTART != 0)
}
END{print subval","count >> "results.txt"}
Files have to be all in the same directory.
Good luck!
Currently I am working very basic game using the C++ environment. The game used to be a school project but now that I am done with that programming class, I wanted to expand my skills and put some more flourish on this old assignment.
I have already made a lot of changes that I am pleased with. I have centralized all the data into folder hierarchies and I have gotten the code to read those locations.
However my problem stems from a very fundamental flaw that has been stumping me.
In order to access the image data that I am using I have used the code:
string imageLocation = "..\\DATA\\Images\\";
string bowImage = imageLocation + "bow.png";
The problem is that when the player picks up an item on the gameboard my code is supposed to use the code:
hud.addLine("You picked up a " + (*itt)->name() + "!");
to print to the command line, "You picked up a Bow!". But instead it shows "You picked up a ..\DATA\Images\!".
Before I centralized my data I used to use:
name_(item_name.substr(0, item_name.find('.')))
in my Item class constructor to chop the item name to just something like bow or candle. After I changed how my data was structured I realized that I would have to change how I chop the name down to the same simple 'bow' or 'candle'.
I have changed the above code to reflect my changes in data structure to be:
name_(item_name.substr(item_name.find("..\\DATA\\Images\\"), item_name.find(".png")))
but unfortunately as I alluded to earlier this change of code is not working as well as I planned it to be.
So now that I have given that real long winded introduction to what my problem is, here is my question.
How do you extract the middle of a string between two sections that you do not want? Also that middle part that is your target is of an unknown length.
Thank you so very much for any help you guys can give. If you need anymore information please ask; I will be more than happy to upload part or even my entire code for more help. Again thank you very much.
In all honeasty, you're probably approaching this from the wrong end.
Your item class should have a string "bow", in a private member. The function Item::GetFilePath would then (at runtime) do "..\DATA\Images\" + this->name + ".png".
The fundamental property of the "bow" item object isn't the filename bow.png, but the fact that it's a "bow". The filename is just a derived proerty.
Assuming I understand you correctly, the short version of your question is: how do I split a string containing a file path so I have removed the path and the extension, leaving just the "title"?
You need the find_last_of method. This gets rid of the path:
std::size_type lastSlash = filePath.find_last_of('\\');
if (lastSlash == std::string::npos)
fileName = filePath;
else
fileName = filePath.substr(lastSlash + 1);
Note that you might want to define a constant as \\ in case you need to change it for other platforms. Not all OS file systems use \\ to separate path segments.
Also note that you also need to use find_last_of for the extension dot as well, because filenames in general can contain dots, throughout their paths. Only the very last one indicates the start of the extension:
std::size_type lastDot = fileName.find_last_of('.');
if (lastDot == std::string::npos)
{
title = fileName;
}
else
{
title = fileName.substr(0, lastDot);
extension = fileName.substr(lastDot + 1);
}
See http://msdn.microsoft.com/en-us/library/3y5atza0(VS.80).aspx
using boost filesystem:
#include "boost/filesystem.hpp"
namespace fs = boost::filesystem;
void some_function(void)
{
string imageLocation = "..\\DATA\\Images\\";
string bowImage = imageLocation + "bow.png";
fs::path image_path( bowImage );
hud.addLine("You picked up a " + image_path.filename() + "!"); //prints: You picked up a bow!
So combining Paul's and my thoughts, try something like this (broken down for readability):
string extn = item_name.substr(item_name.find_last_of(".png"));
string path = item_name.substr(0, item_name.find("..\\DATA\\Images\\"));
name_ = item_name.substr( path.size(), item_name.size() - extn.size() );
You could simplify it a bit if you know that item name always starts with "..DATA" etc (you could store it in a constant and not need to search for it in the string)
Edit: Changed extension finding part to use find_last_of, as suggested by EarWicker, (this avoids the case where your path includes '.png' somewhere before the extension)
item_name.find("..\DATA\Images\") will return the index at which the substring "..\DATA\Images\" starts but it seems like you'd want the index where it ends, so you should add the length of "..\DATA\Images\" to the index returned by find.
Also, as hamishmcn pointed out, the second argument to substr should be the number of chars to return, which would be the index where ".png" starts minus the index where "..\DATA\Images\" ends, I think.
One thing that looks wrong is that the second parameter to substr should be the number of chars to copy, not the position.