I’m trying to use a Python Regular Expression to extract a genome sequence from a genome database; I’ve pasted a snippet of the database below.
>GSVIVT01031739001 pacid=17837850 polypeptide=GSVIVT01031739001 locus=GSVIVG01031739001 ID=GSVIVT01031739001.Genoscope12X annot-version=Genoscope.12X ATGAAAACGGAACTCTTTCTAGGTCATTTCCTCTTCAAACAAGAAAGAAGTAAAAGTTGCATACCAAATATGGACTCGAT TTGGAGTCGTAGTGCCCTGTCCACAGCTTCGGACTTCCTCACTGCAATCTACTTCGCCTTCATCTTCATCGTCGCCAGGT TTTTCTTGGACAGATTCATCTATCGAAGGTTGGCCATCTGGTTATTGAGCAAGGGAGCTGTTCCATTGAAGAAAAATGAT GCTACACTGGGAAAAATTGTAAAATGTTCGGAGTCTTTGTGGAAACTAACATACTATGCAACTGTTGAAGCATTCATTCT TGCTATTTCCTACCAAGAGCCATGGTTTAGAGATTCAAAGCAGTACTTTAGAGGGTGGCCAAATCAAGAGTTGACGCTTC CCCTCAAGCTTTTCTACATGTGCCAATGTGGGTTCTACATCTACAGCATTGCTGCCCTTCTTACATGGGAAACTCGCAGG AGGGATTTCTCTGTGATGATGTCTCATCATGTAGTCACTGTTATCCTAATTGGGTACTCATACATATCAAGTTTTGTCCG GATCGGCTCAGTTGTCCTTGCCCTGCACGATGCAAGTGATGTCTTCATGGAAGCTGCAAAAGTTTTTAAATATTCTGAGA AGGAGCTTGCAGCAAGTGTGTGCTTTGGATTTTTTGCCATCTCATGGCTTGTCCTACGGTTAATATTCTTTCCCTTTTGG GTTATCAGTGCATCAAGCTATGATATGCAAAATTGCATGAATCTATCGGAGGCCTATCCCATGTTGCTATACTATGTTTT CAATACAATGCTCTTGACACTACTTGTGTTCCATATATACTGGTGGATTCTTATATGCTCAATGATTATGAGACAGCTGA AAAATAGAGGACAAGTTGGAGAAGATATAAGATCTGATTCAGAGGACGATGAATAG
>GSVIVT01031740001 pacid=17837851 polypeptide=GSVIVT01031740001 locus=GSVIVG01031740001 ID=GSVIVT01031740001.Genoscope12X annot-version=Genoscope.12X ATGGGTATTACTACTTCCCTCTCATATCTTTTATTCTTCAACATCATCCTCCCAACCTTAACGGCTTCTCCAATACTGTT TCAGGGGTTCAATTGGGAATCATCCAAAAAGCAAGGAGGGTGGTACAACTTCCTCATCAACTCCATTCCTGAACTATCTG CCTCTGGAATCACTCATGTTTGGCTTCCTCCACCCTCTCAGTCTGCTGCATCTGAAGGGTACCTGCCAGGAAGGCTTTAT GATCTCAATGCATCCCACTATGGTACCCAATATGAACTAAAAGCATTGATAAAGGCATTTCGCAGCAATGGGATCCAGTG CATAGCAGACATAGTTATAAACCACAGGACTGCTGAGAAGAAAGATTCAAGAGGAATATGGGCCATCTTTGAAGGAGGAA CCCCAGATGATCGCCTTGACTGGGGTCCATCTTTTATCTGCAGTGATGACACTCTTTTTTCTGATGGCACAGGAAATCCT GATACTGGAGCAGGCTTCGATCCTGCTCCAGACATTGATCATGTAAACCCCCGGGTCCAGCGAGAGCTATCAGATTGGAT GAATTGGTTAAAGATTGAAATAGGCTTTGCTGGATGGCGATTCGATTTTGCTAGAGGATACTCCCCAGATTTTACCAAGT TGTATATGGAAAACACTTCGCCAAACTTTGCAGTAGGGGAAATATGGAATTCTCTTTCTTATGGAAATGACAGTAAGCCA AACTACAACCAAGATGCTCATCGGCGTGAGCTTGTGGACTGGGTGAAAGCTGCTGGAGGAGCAGTGACTGCATTTGATTT TACAACCAAAGGGATACTCCAAGCTGCAGTGGAAGGGGAATTGTGGAGGCTGAAGGACTCAAATGGAGGGCCTCCAGGAA TGATTGGCTTAATGCCTGAAAATGCTGTGACTTTCATAGATAATCATGACACAGGTTCTACACAAAAAATTTGGCCATTC CCATCAGACAAAGTCATGCAGGGATATGTTTATATCCTCACTCATCCTGGGATTCCATCCATATTCTATGACCACTTCTT TGACTGGGGTCTGAAGGAGGAGATTTCTAAGCTGATCAGTATCAGGACCAGGAACGGGATCAAACCCAACAGTGTGGTGC GTATTCTGGCATCTGACCCAGATCTTTATGTAGCTGCCATAGATGAGAAAATCATTGCTAAGATTGGACCAAGGTATGAT GTTGGGAACCTTGTACCTTCAACCTTCAAACTTGCCACCTCTGGCAACAATTATGCTGTGTGGGAGAAACAGTAA
>GSVIVT01031741001 pacid=17837852 polypeptide=GSVIVT01031741001 locus=GSVIVG01031741001 ID=GSVIVT01031741001.Genoscope12X annot-version=Genoscope.12X ATGTCCAAATTAACTTATTTATTATCTCGGTACATGCCAGGAAGGCTTTATGATCTGAATGCATCCAAATATGGCACCCA AGATGAACTGAAAACACTGATAAAGGTGTTTCACAGCAAGGGGGTCCAGTGCATAGCAGACATAGTTATAAACCACAGAA CTGCAGAGAAGCAAGACGCAAGAGGAATATGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGACCCCAT CTTTCCTTTGCAAGGACGACACTCCTTATTCCGACGGCACCGGAAACCCTGATTCTGGAGATGACTACAGTGCCGCACCA GACATCGACCACATCAACCCACGGGTTCAGCAAGAGCTAA
What I’m trying to do is get the genome (ACGT) sequence for GSVIV01031740001 (the middle sequence), and none of the others. My current regex is
sequence = re.compile('(?<=>GSVIVT01031740001) pacid=.*annot-version=.*\n[ACGT\n]*[^(?<!>GSVIVT01031740001) pacid]’)
with my logic being find the header with the genbank ID for the correct organism, give me that line, then go to a new line and give me all ACGT and new lines until I get to a header for an organism with a different genbank ID. This fails to give any results.
Yes, I know that re.compile doesn’t actually perform a search; I’m searching against a file opened as ‘target’ so my execution looks like
>>> for nucl in target:
... if re.search(sequence, nucl):
... print(nucl)
Can someone tell me what I’m doing wrong, either in my regex or by using regex in the first place? When I try this on regex101.com, it works, but when I try it in the Python interpreter (2.7.1), it fails.
Thanks!
If I understand correctly , you want JUST the genomic sequence for a given locus. So You can do something like this.(assumes your data is in a file)
lines = [line.split(' ') for line in open('results.txt') ]
somedict = {}
for each in lines:
locus = each[3].split('=')[-1]
seq = ''.join(each[6:])
somedict[locus] = seq
print somedict
It outputs a dictionary with the locus as key and sequence as value
{'GSVIVG01031741001': 'ATGTCCAAATTAACTTATTTATTATCTCGGTACATGCCAGGAAGGCTTTATGATCTGAATGCATCCAAATATGGCACCCAAGATGAACTGAAAACACTGATAAAGGTGTTTCACAGCAAGGGGGTCCAGTGCATAGCAGACATAGTTATAAACCACAGAACTGCAGAGAAGCAAGACGCAAGAGGAATATGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGACCCCATCTTTCCTTTGCAAGGACGACACTCCTTATTCCGACGGCACCGGAAACCCTGATTCTGGAGATGACTACAGTGCCGCACCAGACATCGACCACATCAACCCACGGGTTCAGCAAGAGCTAA\n', 'GSVIVG01031740001': 'ATGGGTATTACTACTTCCCTCTCATATCTTTTATTCTTCAACATCATCCTCCCAACCTTAACGGCTTCTCCAATACTGTTTCAGGGGTTCAATTGGGAATCATCCAAAAAGCAAGGAGGGTGGTACAACTTCCTCATCAACTCCATTCCTGAACTATCTGCCTCTGGAATCACTCATGTTTGGCTTCCTCCACCCTCTCAGTCTGCTGCATCTGAAGGGTACCTGCCAGGAAGGCTTTATGATCTCAATGCATCCCACTATGGTACCCAATATGAACTAAAAGCATTGATAAAGGCATTTCGCAGCAATGGGATCCAGTGCATAGCAGACATAGTTATAAACCACAGGACTGCTGAGAAGAAAGATTCAAGAGGAATATGGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGGGTCCATCTTTTATCTGCAGTGATGACACTCTTTTTTCTGATGGCACAGGAAATCCTGATACTGGAGCAGGCTTCGATCCTGCTCCAGACATTGATCATGTAAACCCCCGGGTCCAGCGAGAGCTATCAGATTGGATGAATTGGTTAAAGATTGAAATAGGCTTTGCTGGATGGCGATTCGATTTTGCTAGAGGATACTCCCCAGATTTTACCAAGTTGTATATGGAAAACACTTCGCCAAACTTTGCAGTAGGGGAAATATGGAATTCTCTTTCTTATGGAAATGACAGTAAGCCAAACTACAACCAAGATGCTCATCGGCGTGAGCTTGTGGACTGGGTGAAAGCTGCTGGAGGAGCAGTGACTGCATTTGATTTTACAACCAAAGGGATACTCCAAGCTGCAGTGGAAGGGGAATTGTGGAGGCTGAAGGACTCAAATGGAGGGCCTCCAGGAATGATTGGCTTAATGCCTGAAAATGCTGTGACTTTCATAGATAATCATGACACAGGTTCTACACAAAAAATTTGGCCATTCCCATCAGACAAAGTCATGCAGGGATATGTTTATATCCTCACTCATCCTGGGATTCCATCCATATTCTATGACCACTTCTTTGACTGGGGTCTGAAGGAGGAGATTTCTAAGCTGATCAGTATCAGGACCAGGAACGGGATCAAACCCAACAGTGTGGTGCGTATTCTGGCATCTGACCCAGATCTTTATGTAGCTGCCATAGATGAGAAAATCATTGCTAAGATTGGACCAAGGTATGATGTTGGGAACCTTGTACCTTCAACCTTCAAACTTGCCACCTCTGGCAACAATTATGCTGTGTGGGAGAAACAGTAA\n', 'GSVIVG01031739001': 'ATGAAAACGGAACTCTTTCTAGGTCATTTCCTCTTCAAACAAGAAAGAAGTAAAAGTTGCATACCAAATATGGACTCGATTTGGAGTCGTAGTGCCCTGTCCACAGCTTCGGACTTCCTCACTGCAATCTACTTCGCCTTCATCTTCATCGTCGCCAGGTTTTTCTTGGACAGATTCATCTATCGAAGGTTGGCCATCTGGTTATTGAGCAAGGGAGCTGTTCCATTGAAGAAAAATGATGCTACACTGGGAAAAATTGTAAAATGTTCGGAGTCTTTGTGGAAACTAACATACTATGCAACTGTTGAAGCATTCATTCTTGCTATTTCCTACCAAGAGCCATGGTTTAGAGATTCAAAGCAGTACTTTAGAGGGTGGCCAAATCAAGAGTTGACGCTTCCCCTCAAGCTTTTCTACATGTGCCAATGTGGGTTCTACATCTACAGCATTGCTGCCCTTCTTACATGGGAAACTCGCAGGAGGGATTTCTCTGTGATGATGTCTCATCATGTAGTCACTGTTATCCTAATTGGGTACTCATACATATCAAGTTTTGTCCGGATCGGCTCAGTTGTCCTTGCCCTGCACGATGCAAGTGATGTCTTCATGGAAGCTGCAAAAGTTTTTAAATATTCTGAGAAGGAGCTTGCAGCAAGTGTGTGCTTTGGATTTTTTGCCATCTCATGGCTTGTCCTACGGTTAATATTCTTTCCCTTTTGGGTTATCAGTGCATCAAGCTATGATATGCAAAATTGCATGAATCTATCGGAGGCCTATCCCATGTTGCTATACTATGTTTTCAATACAATGCTCTTGACACTACTTGTGTTCCATATATACTGGTGGATTCTTATATGCTCAATGATTATGAGACAGCTGAAAAATAGAGGACAAGTTGGAGAAGATATAAGATCTGATTCAGAGGACGATGAATAG\n'}
Related
I am trying to extract and preprocess log data for a use case.
For instance, the log consists of problem numbers with information to each ID underneath. Each element starts with:
#!#!#identification_number###96245#!#!#change_log###
action
action1
change
#!#!#attribute###value_change
#!#!#attribute1###status_change
#!#!#attribute2###<None>
#!#!#attribute3###status_change_fail
#!#!#attribute4###value_change
#!#!#attribute5###status_change
#!#!#identification_number###96246#!#!#change_log###
action
change
change1
action1
#!#!#attribute###value_change
#!#!#attribute1###status_change_fail
#!#!#attribute2###value_change
#!#!#attribute3###status_change
#!#!#attribute4###value_change
#!#!#attribute5###status_change
I extracted the identification numbers and saved them as a .csv file:
f = open(r'C:\Users\reszi\Desktop\Temp\output_new.txt', encoding="utf8")
change_log = f.readlines()
number = re.findall('#!#!#identification_number###(.+?)#!#!#change_log###', change_log)
Now what I am trying to achieve is, that for every ID in the .csv file I can append the corresponding log content, which is:
action
change
#!#!#attribute###
Since I am rather new to Python and only started working with regex a few days ago, I was hoping for some help.
Each log for an ID starts with "#!#!identification_number###" and ends with "#!#!attribute5### <entry>".
I have tried the following code, but the result is empty:
In:
x = re.findall("\[^#!#!#identification_number###((.|\n)*)#!#!#attribute5###((.|\n)*)$]", str(change_log))
In:
print(x)
Out:
[]
Try this:
pattern='entification_number###(.+?)#!#!#change_log###(.*?)#!#!#id'
re.findall(pattern, string+'#!#!#id', re.DOTALL)
The dotall flag makes the point match newline, so hopefully in the second capturing group you will find the logs.
If you want to get the attributes, for each identification number, you can parse the logs (got for the search above) of each id number with the following:
pattern='#!#!#attribute(.*?)###(.*?)#!#'
re.findall(pattern, string_for_each_log_match+'#!#', re.DOTALL)
If you put each id into the regex when you search using string.format() you can grab the lines that contain the correct changelog.
with open(r'path\to\csv.csv', 'r') as f:
ids = f.readlines()
with open(r'C:\Users\reszi\Desktop\Temp\output_new.txt', encoding="utf8") as f:
change_log = f.readlines()
matches = {}
for id_no in ids:
for i in range(len(change_log)):
reg = '#!#!#identification_number###({})#!#!#change_log###'.format(id_no)
if re.search(reg, change_log[i]):
matches[id_no] = i
break
This will create a dictionary with the structure {id_no:line_no,...}.
So once you have all of the lines that tell you where each log starts, you can grab the lines you want that come after these lines.
I am trying to extract a dynamic value (static characters) from a csv file in a specific column and output the value to another csv.
The data element I am trying to extract is '12385730561818101591' from the value 'callback=B~12385730561818101591' located in a specific column.
I have written the below python script, but the output results are always blank. The regex '=(~[0-9]+)' was validated to successfully pull out the '12385730561818101591' value. This was tested on www.regex101.com.
When I use this in Python, no results are displayed in the output file. I have a feeling the '~' is causing the error. When I tried searching for '~' in the original CSV file, no results were found, but it is there!
Can the community help me with the following:
(1) Determine root cause of no output and validate if '~' is the problem. Could the problem also be the way I'm splitting the rows? I'm not sure if the rows should be split by ';' instead of ','.
import csv
import sys
import ast
import re
filename1 = open("example.csv", "w")
with open('example1.csv') as csvfile:
data = None
patterns = '=(~[0-9]+)'
data1= csv.reader(csvfile)
for row in data1:
var1 = row[57]
for item in var1.split(','):
if re.search(patterns, item):
for data in item:
if 'common' in data:
filename1.write(data + '\n')
filename1.close()
Here I have tried to write sample code. Hope this will help you in solving the problem:
import re
str="callback=B~12385730561818101591"
rc=re.match(r'.*=B\~([0-9A-Ba-b]+)', str)
print rc.group(1)
You regex is wrong for your example :
=(~[0-9]+) will never match callback=B~12385730561818101591 because of the B after the = and before the ~.
Also you include the ~ in the capturing group.
Not exatly sure what's your goal but this could work. Give more details if you have more restrictions.
=.+~([0-9]+)
EDIT
Following the new provided information :
patterns = '=.+~([0-9]+)'
...
result = re.search(patterns, item):
number = result.group(0)
filename1.write(number + '\n')
...
Concerning your line split on the \t (tabulation) you should show an example of the full line
I'm trying to write a script to update a text file by replacing instances of certain characters, (i.e. 'a', 'w') with a word (i.e. 'airplane', 'worm').
If a single line of the text was something like this:
a.function(); a.CallMethod(w); E.aa(w);
I'd want it to become this:
airplane.function(); airplane.CallMethod(worm); E.aa(worm);
The difference is subtle but important, I'm only changing 'a' and 'w' where it's used as a variable, not just another character in some other word. And there's many lines like this in the file. Here's what I've done so far:
original = open('original.js', 'r')
modified = open('modified.js', 'w')
# iterate through each line of the file
for line in original:
# Search for the character 'a' when not part of a word of some sort
line = re.sub(r'\W(a)\W', 'airplane', line)
modified.write(line)
original.close()
modified.close()
I think my RE pattern is wrong, and I think i'm using the re.sub() method incorrectly as well. Any help would be greatly appreciated.
If you're concerned about the semantic meaning of the text you're changing with a regular expression, then you'd likely be better served by parsing it instead. Luckily python has two good modules to help you with parsing Python. Look at the Abstract Syntax Tree and the Parser modules. There's probably others for JavaScript if that's what you're doing; like slimit.
Future reference on Regular Expression questions, there's a lot of helpful information here:
https://stackoverflow.com/tags/regex/info
Reference - What does this regex mean?
And it took me 30 minutes from never having used this JavaScript parser in Python (replete with installation issues: please note the right ply version) to writing a basic solution given your example. You can too.
# Note: sudo pip3 install ply==3.4 && sudo pip3 install slimit
from slimit import ast
from slimit.parser import Parser
from slimit.visitors import nodevisitor
data = 'a.funktion(); a.CallMethod(w); E.aa(w);'
tree = Parser().parse(data)
for node in nodevisitor.visit(tree):
if isinstance(node, ast.Identifier):
if node.value == 'a':
node.value = 'airplaine'
elif node.value == 'w':
node.value = 'worm'
print(tree.to_ecma())
It runs to give this output:
$ python3 src/python_renames_js_test.py
airplaine.funktion();
airplaine.CallMethod(worm);
E.aa(worm);
Caveats:
function is a reserved word, I used funktion
the to_ecma method pretty prints; there is likely another way to output it closer to the original input.
line = re.sub(r'\ba\b', 'airplane', line)
should get you closer. However, note that you will also be replacing a.CallMethod("That is a house") into airplane("That is airplane house"), and open("file.txt", "a") into open("file.txt", "airplane"). Getting it right in a complex syntax environment using RegExp is hard-to-impossible.
I have a CSV file containing user (tweetid, tweets, userid).
396124436476092416,"Think about the life you livin but don't think so hard it hurts Life is truly a gift, but at the same it is a curse",Obey_Jony09
396124436740317184,"“#BleacherReport: Halloween has given us this amazing Derrick Rose photo (via #amandakaschube, #ScottStrazzante) http://t.co/tM0wEugZR1” yes",Colten_stamkos
396124436845178880,"When's 12.4k gonna roll around",Matty_T_03
Now I need to write a Pig Query that returns all the tweets that include the word 'favorite', ordered by tweet id.
For this I have the following code:
A = load '/user/pig/tweets' as (line);
B = FOREACH A GENERATE FLATTEN(REGEX_EXTRACT_ALL(line,'(.*)[,”:-](.*)[“,:-](.*)')) AS (tweetid:long,msg:chararray,userid:chararray);
C = filter B by msg matches '.*favorite.*';
D = order C by tweetid;
How does the regular expression work here in splitting the output in desired way?
I tried using REGEX_EXTRACT instead of REGEX_EXTRACT_ALL as I find that much more simpler, but couldn't get the code working except for extracting just the tweets:
B = FOREACH A GENERATE FLATTEN(REGEX_EXTRACT(line,'[,”:-](.*)[“,:-]',1)) AS (msg:chararray);
the above alias gets me the tweets, but if I use REGEX_EXTRACT to get the tweet_id, I do not get the desired o/p: B = FOREACH A GENERATE FLATTEN(REGEX_EXTRACT(line,'(.*)[,”:-]',1)) AS (tweetid:long);
(396124554353197056,"Just saw #samantha0wen and #DakotaFears at the drake concert #waddup")
(396124554172432384,"#Yutika_Diwadkar I'm just so bright 😁")
(396124554609033216,"#TB23GMODE i don't know, i'm just saying, why you in GA though? that's where you from?")
(396124554805776385,"#MichaelThe_Lion me too 😒")
(396124552540852226,"Happy Halloween from us 2 #maddow & #Rev_AlSharpton :) http://t.co/uC35lDFQYn")
grunt>
Please help.
Can't comment, but from looking at this and testing it out, it looks like your quotes in the regex are different from those in the csv.
" in the csv
” in the regex code.
To get the tweetid try this:
B = FOREACH A GENERATE FLATTEN(REGEX_EXTRACT(line,'.*(,")',1)) AS (tweetid:long);
Hi so I'm trying to use find and replace in notepad++ with regular expression to do the following:
I have two set of lines
first set:
[c][eu][e]I37ANKCB[/e]
[c][eu][e]OIL8ZEPW[/e]
[c][eu][e]4OOEL75O[/e]
[c][eu][e]PPNW5FN4[/e]
[c][eu][e]E2BXCWUO[/e]
[c][eu][e]SD9UQNT8[/e]
[c][eu][e]E6BK6IGO[/e]
second set:
[u]7ubju2jvioks[u2]_261
[u]89j408tah1lz[u2]_262
[u]j673xnd49tq0[u2]_263
[u]dv73osmh1wzu[u2]_264
[u]twz3u4yiaeqr[u2]_265
[u]cuhtg6r71kud[u2]_266
[u]yts0ktvt9a3r[u2]_267
now I want to the second set to by places after each of the first set like this:
[c][eu][e]I37ANKCB[/e][u]7ubju2jvioks[u2]_261
[c][eu][e]OIL8ZEPW[/e][u]89j408tah1lz[u2]_262
[c][eu][e]4OOEL75O[/e][u]j673xnd49tq0[u2]_263
[c][eu][e]PPNW5FN4[/e][u]dv73osmh1wzu[u2]_264
[c][eu][e]E2BXCWUO[/e][u]twz3u4yiaeqr[u2]_265
[c][eu][e]SD9UQNT8[/e][u]cuhtg6r71kud[u2]_266
[c][eu][e]E6BK6IGO[/e][u]yts0ktvt9a3r[u2]_267
any suggestions?
You can mark the second block in column mode using ALT and the left mouse button. Then just copy paste it at the end of the first row.
No need/Not possible using regex.
I would solve this via a simple script written in Python or Ruby or something equally quick. This works, for example:
import os
path = os.path.dirname(__file__)
with open(os.path.join(path, 'file1')) as file1:
with open(os.path.join(path, 'file2')) as file2:
lines = zip(file1.readlines(), file2.readlines())
print ''.join([a.rstrip() + b for a, b in lines])
Running it gives the correct result:
> python join.py
[c][eu][e]I37ANKCB[/e][u]7ubju2jvioks[u2]_261
[c][eu][e]OIL8ZEPW[/e][u]89j408tah1lz[u2]_262
[c][eu][e]4OOEL75O[/e][u]j673xnd49tq0[u2]_263
[c][eu][e]PPNW5FN4[/e][u]dv73osmh1wzu[u2]_264
[c][eu][e]E2BXCWUO[/e][u]twz3u4yiaeqr[u2]_265
[c][eu][e]SD9UQNT8[/e][u]cuhtg6r71kud[u2]_266
[c][eu][e]E6BK6IGO[/e][u]yts0ktvt9a3r[u2]_267
Customize to suit your needs.