I have been programming a while but I am fairly new to C++. I am writing a program that takes an .exe and gets its hex and stores it in and unsigned char array. I can take in the .exe and return its hex fine. My problem is I am having trouble storing the hex in the correct format in the char array.
When I print the array it outputs the hex but I need to add 0x to the front.
Sample output: 04 5F 4B F4 C5 A5
Needed output: 0x04 0x5F 0x4B 0xF4 0xC5 0xA5
I am trying to use hexcode[i] = ("0x%.2X", (unsigned char)c); to store it correctly and it still only seems to return the last two chars without the 0x.
I have also tried hexcode[i] = '0x' + (unsigned char)c; and looked into functions like sprintf.
Can anyone help me get my desired output? Is it even possible?
Full program -
#include <iostream>
unsigned char hexcode[99999] = { 0 };
//Takes exes hex and place it into unsigned char array
int hexcoder(std::string file) {
FILE *sf; //executable file
int i, c;
sf = fopen(file.c_str(), "rb");
if (sf == NULL) {
fprintf(stderr, "Could not open file.", file.c_str());
return 1;
}
for (i = 0;;i++) {
if ((c = fgetc(sf)) == EOF) break;
hexcode[i] = ("0x%.2X", (unsigned char)c);
//Print for debug
std::cout << std::hex << static_cast<int>(hexcode[i]) << ' ';
}
}
int main()
{
std::string file = "shuffle.exe"; // test exe to pass to get hex
hexcoder(file);
system("pause");
return 0;
}
I suppose you want to dump a file in hex format. So maybe it's something like the following code you are looking for.
Note that hexcode is changed to data type char instead of unsigned char such that it can be handled as a string containing printable characters.
int hexcoder(std::string file) {
FILE *sf; //executable file
int i, c;
sf = fopen(file.c_str(), "rb");
if (sf == NULL) {
fprintf(stderr, "Could not open file %s.", file.c_str());
return 1;
}
char hexcode[10000];
char* wptr = hexcode;
for (i = 0;;i++) {
if ((c = fgetc(sf)) == EOF) break;
wptr += sprintf(wptr,"0x%02X ", c);
}
*wptr = 0;
std::cout << hexcode;
return 0;
}
BTW: for printing out a value in hex format one could as well use...
printf("0x%2X ", c)
or
std::cout << "0x" << std::hex << std::setw(2) << std::setfill('0') << std::uppercase << c << " ";
Note that the latter requires #include <iomanip>.
But - in order to not change the semantics of your code too much - I kept the hexcode-string as target.
Related
In C++ I can initialize a vector using
std::vector<uint8_t> data = {0x01, 0x02, 0x03};
For convenience (I have python byte strings that naturally output in a dump of hex), I would like to initialize for a non-delimited hex value of the form:
std::vector<uint8_t> data = 0x229597354972973aabbe7;
Is there a variant of this that is valid c++?
Combining comments from Evg, JHbonarius and 1201ProgramAlarm:
The answer is that there is no direct way to group but a long hex value into a vector, however, using user defined literals provides a clever notation improvement.
First, using RHS 0x229597354972973aabbe7 anywhere in the code will fail because because unsuffixed literals are assumed to be of type int and will fail to be contained in the register. In MSVC, result in E0023 "integer constant is too large". Limiting to smaller hex sequences or exploring large data types may be possible with suffixed notation, but this would ruin any desire for simplicity.
Manual conversion is necessary, but user defined literals may provide a slightly more elegant notation. For example, we can enable conversion of a hex sequence to a vector with
std::vector<uint8_t> val1 = 0x229597354972973aabbe7_hexvec;
std::vector<uint8_t> val2 = "229597354972973aabbe7"_hexvec;
using the following code:
#include <vector>
#include <iostream>
#include <string>
#include <algorithm>
// Quick Utlity function to view results:
std::ostream & operator << (std::ostream & os, std::vector<uint8_t> & v)
{
for (const auto & t : v)
os << std::hex << (int)t << " ";
return os;
}
std::vector<uint8_t> convertHexToVec(const char * str, size_t len)
{
// conversion takes strings of form "FFAA54" or "0x11234" or "0X000" and converts to a vector of bytes.
// Get the first two characters and skip them if the string starts with 0x or 0X for hex specification:
std::string start(str, 2);
int offset = (start == "0x" || start == "0X") ? 2 : 0;
// Round up the number of groupings to allow for ff_hexvec fff_hexvec and remove the offset to properly count 0xfff_hexvec
std::vector<uint8_t> result((len + 1 - offset) / 2);
size_t ind = result.size() - 1;
// Loop from right to left in in pairs of two but watch out for a lone character on the left without a pair because 0xfff_hexvec is valid:
for (const char* it = str + len - 1; it >= str + offset; it -= 2) {
int val = (str + offset) > (it - 1); // check if taking 2 values will run off the start and use this value to reduce by 1 if we will
std::string s(std::max(it - 1, str + offset), 2 - val);
result[ind--] = (uint8_t)stol(s, nullptr, 16);
}
return result;
}
std::vector<uint8_t> operator"" _hexvec(const char*str, std::size_t len)
{
// Handles the conversion form "0xFFAABB"_hexvec or "12441AA"_hexvec
return convertHexToVec(str, len);
}
std::vector<uint8_t> operator"" _hexvec(const char*str)
{
// Handles the form 0xFFaaBB_hexvec and 0Xf_hexvec
size_t len = strlen(str);
return convertHexToVec(str, len);
}
int main()
{
std::vector<uint8_t> v;
std::vector<uint8_t> val1 = 0x229597354972973aabbe7_hexvec;
std::vector<uint8_t> val2 = "229597354972973aabbe7"_hexvec;
std::cout << val1 << "\n";
std::cout << val2 << "\n";
return 0;
}
The coder must decide whether this is superior to implementing and using a more traditional convertHexToVec("0x41243124FF") function.
Is there a variant of this that is valid c++?
I think not.
The following code is valid C++, and uses a more "traditional hex conversion" process.
Confirm and remove the leading '0x', also confirm that all chars are
hex characters.
modifyFor_SDFE() - 'space delimited format extraction'
This function inserts spaces around the two char byte descriptors.
Note that this function also adds a space char at front and back of the modified string. This new string is used to create and initialize a std::stringstream (ss1).
By inserting the spaces, the normal stream "formatted extraction" works cleanly
The code extracts each hex value, one by one, and pushes each into the vector, and ends when last byte is pushed (stream.eof()). Note the vector automatically grows as needed (no overflow will occur).
Note that the '0x' prefix is not needed .. because the stream mode is set to hex.
Note that the overflow concern (expressed above as "0x22...be7 is likely to overflow." has been simply side-stepped, by reading only a byte at a time. It might be convenient in future efforts to use much bigger hex strings.
#include <iostream>
using std::cout, std::cerr, std::endl, std::hex,
std::dec, std::cin, std::flush; // c++17
#include <iomanip>
using std::setw, std::setfill;
#include <string>
using std::string;
#include <sstream>
using std::stringstream;
#include <vector>
using std::vector;
typedef vector<uint8_t> UI8Vec_t;
#include <cstdint>
#include <cassert>
class F889_t // Functor ctor and dtor use compiler provided defaults
{
bool verbose;
public:
int operator()(int argc, char* argv[]) // functor entry
{
verbose = ( (argc > 1) ? ('V' == toupper(argv[1][0])) : false );
return exec(argc, argv);
}
// 2 lines
private:
int exec(int , char** )
{
UI8Vec_t resultVec; // output
// example1 input
// string data1 = "0x229597354972973aabbe7"; // 23 chars, hex string
// to_ui8_vec(resultVec, data1);
// cout << (verbose ? "" : "\n") << " vector result "
// << show(ui8Vec); // show results
// example2 input 46 chars (no size limit)
string data = "0x330508465083084bBCcf87eBBaa379279543795922fF";
to_ui8_vec (resultVec, data);
cout << (verbose ? " vector elements " : "\n ")
<< show(resultVec) << endl; // show results
if(verbose) { cout << "\n F889_t::exec() (verbose) ("
<< __cplusplus << ")" << endl; }
return 0;
} // int exec(int, char**)
// 7 lines
void to_ui8_vec(UI8Vec_t& retVal, // output (pass by reference)
string sData) // input (pass by value)
{
if(verbose) { cout << "\n input data '" << sData
<< "' (" << sData.size() << " chars)" << endl;}
{ // misc format checks:
size_t szOrig = sData.size();
{
// confirm leading hex indicator exists
assert(sData.substr(0,2) == string("0x"));
sData.erase(0,2); // discard leading "0x"
}
size_t sz = sData.size();
assert(sz == (szOrig - 2)); // paranoia
// to test that this will detect any typos in data:
// temporarily append or insert an invalid char, i.e. sData += 'q';
assert(sData.find_first_not_of("0123456789abcdefABCDEF") == std::string::npos);
}
modifyFor_SDFE (sData); // SDFE - 'Space Delimited Formatted Extraction'
stringstream ss1(sData); // create / initialize stream with SDFE
if(verbose) { cout << " SDFE data '" << ss1.str() // echo init
<< "' (" << sData.size() << " chars)" << endl; }
extract_values_from_SDFE_push_back_into_vector(retVal, ss1);
} // void to_ui8_vec (vector<uint8_t>&, string)
// 13 lines
// modify s (of any size) for 'Space Delimited Formatted Extraction'
void modifyFor_SDFE (string& s)
{
size_t indx = s.size();
while (indx > 2)
{
indx -= 2;
s.insert (indx, 1, ' '); // indx, count, delimiter
}
s.insert(0, 1, ' '); // delimiter at front of s
s += ' '; // delimiter at tail of s
} // void modifyFor_SDFE (string&)
// 6 lines
void extract_values_from_SDFE_push_back_into_vector(UI8Vec_t& retVal,
stringstream& ss1)
{
do {
uint n = 0;
ss1 >> hex >> n; // use SDFE, hex mode - extract one field at a time
if(!ss1.good()) // check ss1 state
{
if(ss1.eof()) break; // quietly exit, this is a normal stream exit
// else make some noise before exit loop
cerr << "\n err: data input line invalid [" << ss1.str() << ']' << endl; break;
}
retVal.push_back(static_cast<uint8_t>(n & 0xff)); // append to vector
} while(true);
} // void extract_from_SDFE_push_back_to_vector(UI8Vec_t& , string)
// 6 lines
string show(const UI8Vec_t& ui8Vec)
{
stringstream ss ("\n ");
for (uint i = 0; i < ui8Vec.size(); ++i) {
ss << setfill('0') << setw(2) << hex
<< static_cast<int>(ui8Vec[i]) << ' '; }
if(verbose) { ss << " (" << dec << ui8Vec.size() << " elements)"; }
return ss.str();
}
// 5 lines
}; // class F889_t
int main(int argc, char* argv[]) { return F889_t()(argc, argv); }
Typical outputs when invoked with 'verbose' second parameter
$ ./dumy889 verbose
input data '0x330508465083084bBCcf87eBBaa379279543795922fF' (46 chars)
SDFE data ' 33 05 08 46 50 83 08 4b BC cf 87 eB Ba a3 79 27 95 43 79 59 22 fF ' (67 chars)
vector elements 33 05 08 46 50 83 08 4b bc cf 87 eb ba a3 79 27 95 43 79 59 22 ff (22 elements)
When invoked with no parameters
$ ./dumy889
33 05 08 46 50 83 08 4b bc cf 87 eb ba a3 79 27 95 43 79 59 22 ff
The line counts do not include empty lines, nor lines that are only a comment or only a brace. You may count the lines as you wish.
Im trying to read blocks of data from a file, but I couldn't know how to ignore the newline character when I use istream::read.
Im aware that I can use for loop to load the characters to a cstring one by one with condition to ignore new lines character, but I hope there is clever way to solve this problem.
My intention to avoid using strings or vectors.
#include <iostream>
#include <fstream>
#include <cstring>
void readIt(char* fileName) {
std::ifstream seqsFile;
seqsFile.open(fileName) ;
if (seqsFile.fail()) {
std::cout << "Failed in opening: " << fileName << std::endl;
std::exit(1);
}
seqsFile.seekg(84);
char *buffer;
buffer = new char [7];
seqsFile.read(buffer, 7);
buffer[7] = 0;
std::cout << buffer << std::endl;
}
int main(int argc, char** argv) {
readIt(argv[1]);
return 0;
}
file:
gsi|33112219|sp|O
GACATTCTGGTGGTGGACTCGGAGGCATGATAGCAGGTGCAGCTGGTGCAGCCGCAGCAGCTTATGGAGC
GCAGCAGCTTATGGAGC
current output:
GAGC
GC
desired output:
GAGCGCA
modified version:
void readIt(char* fileName) {
std::ifstream seqsFile;
seqsFile.open(fileName) ;
if (seqsFile.fail()) {
std::cout << "Failed in opening: " << fileName << std::endl;
std::exit(1);
}
seqsFile.seekg(84);
char *buffer;
buffer = new char [7];
char next ;
for ( int i = 0 ; i < 7; i++) {
seqsFile.get(next);
if (next=='\n') {
i--;
continue;
}
buffer[i] = next;
}
buffer[7]=0;
std::cout << buffer << std::endl;
}
Your program has undefined behavior since you are modifying buffer using an out of range index. You have:
buffer = new char [7]; // Allocating 7 chars.
seqsFile.read(buffer, 7); // Reading 7 chars. OK.
buffer[7] = 0; // 7 is an out of range index. Not OK.
Allocate memory for at least 8 chars.
buffer = new char [8];
Also, when you intend to read the contents of a file using istream::read, it is recommended that you open the file in binary mode.
seqsFile.open(fileName, std::ios_base::binary) ;
Well, you can not tell not to read newlines - they will appear in your buffer variable anyway and you have to handle it.
Also, you have to fix the buffer size, as R Sahu mentioned
Regarding your question, i can suggest following snippet:
while ((index = strlen(buffer)) < 7)
{
seqsFile >> &buffer[index];
}
strlen here will return size of buffer upto /0 or newline character as well
You didn't tell what to do with whitespaces, so they will be ignored as well
I have a problem I neither can solve on my own nor find answer anywhere. I have a file contains such a string:
01000000d08c9ddf0115d1118c7a00c04
I would like to read the file in the way, that I would do manually like that:
char fromFile[] =
"\x01\x00\x00\x00\xd0\x8c\x9d\xdf\x011\x5d\x11\x18\xc7\xa0\x0c\x04";
I would really appreciate any help.
I want to do it in C++ (the best would be vc++).
Thank You!
int t194(void)
{
// imagine you have n pair of char, for simplicity,
// here n is 3 (you should recognize them)
char pair1[] = "01"; // note:
char pair2[] = "8c"; // initialize with 3 char c-style strings
char pair3[] = "c7"; //
{
// let us put these into a ram based stream, with spaces
std::stringstream ss;
ss << pair1 << " " << pair2 << " " << pair3;
// each pair can now be extracted into
// pre-declared int vars
int i1 = 0;
int i2 = 0;
int i3 = 0;
// use formatted extractor to convert
ss >> i1 >> i2 >> i3;
// show what happened (for debug only)
std::cout << "Confirm1:" << std::endl;
std::cout << "i1: " << i1 << std::endl;
std::cout << "i2: " << i2 << std::endl;
std::cout << "i3: " << i3 << std::endl << std::endl;
// output is:
// Confirm1:
// i1: 1
// i2: 8
// i3: 0
// Shucks, not correct.
// We know the default radix is base 10
// I hope you can see that the input radix is wrong,
// because c is not a decimal digit,
// the i2 and i3 conversions stops before the 'c'
}
// pre-delcare
int i1 = 0;
int i2 = 0;
int i3 = 0;
{
// so we try again, with radix info added
std::stringstream ss;
ss << pair1 << " " << pair2 << " " << pair3;
// strings are already in hex, so we use them as is
ss >> std::hex // change radix to 16
>> i1 >> i2 >> i3;
// now show what happened
std::cout << "Confirm2:" << std::endl;
std::cout << "i1: " << i1 << std::endl;
std::cout << "i2: " << i2 << std::endl;
std::cout << "i3: " << i3 << std::endl << std::endl;
// output now:
// i1: 1
// i2: 140
// i3: 199
// not what you expected? Though correct,
// now we can see we have the wrong radix for output
// add output radix to cout stream
std::cout << std::hex // add radix info here!
<< "i1: " << i1 << std::endl
// Note: only need to do once for std::cout
<< "i2: " << i2 << std::endl
<< "i3: " << i3 << std::endl << std::endl
<< std::dec;
// output now looks correct, and easily comparable to input
// i1: 1
// i2: 8c
// i3: c7
// So: What next?
// read the entire string of hex input into a single string
// separate this into pairs of chars (perhaps using
// string::substr())
// put space separated pairs into stringstream ss
// extract hex values until ss.eof()
// probably should add error checks
// and, of course, figure out how to use a loop for these steps
//
// alternative to consider:
// read 1 char at a time, build a pairing, convert, repeat
}
//
// Eventually, you should get far enough to discover that the
// extracts I have done are integers, but you want to pack them
// into an array of binary bytes.
//
// You can go back, and recode to extract bytes (either
// unsigned char or uint8_t), which you might find interesting.
//
// Or ... because your input is hex, and the largest 2 char
// value will be 0xff, and this fits into a single byte, you
// can simply static_cast them (I use unsigned char)
unsigned char bin[] = {static_cast<unsigned char>(i1),
static_cast<unsigned char>(i2),
static_cast<unsigned char>(i3) };
// Now confirm by casting these back to ints to cout
std::cout << "Confirm4: "
<< std::hex << std::setw(2) << std::setfill('0')
<< static_cast<int>(bin[0]) << " "
<< static_cast<int>(bin[1]) << " "
<< static_cast<int>(bin[2]) << std::endl;
// you also might consider a vector (and i prefer uint8_t)
// because push_back operations does a lot of hidden work for you
std::vector<uint8_t> bytes;
bytes.push_back(static_cast<uint8_t>(i1));
bytes.push_back(static_cast<uint8_t>(i2));
bytes.push_back(static_cast<uint8_t>(i3));
// confirm
std::cout << "\nConfirm5: ";
for (size_t i=0; i<bytes.size(); ++i)
std::cout << std::hex << std::setw(2) << std::setfill(' ')
<< static_cast<int>(bytes[i]) << " ";
std::cout << std::endl;
Note: The cout (or ss) of bytes or char can be confusing, not always giving the result you might expect. My background is embedded software, and I have surprisingly small experience making stream i/o of bytes work. Just saying this tends to bias my work when dealing with stream i/o.
// other considerations:
//
// you might read 1 char at a time. this can simplify
// your loop, possibly easier to debug
// ... would you have to detect and remove eoln? i.e. '\n'
// ... how would you handle a bad input
// such as not hex char, odd char count in a line
//
// I would probably prefer to use getline(),
// it will read until eoln(), and discard the '\n'
// then in each string, loop char by char, creating char pairs, etc.
//
// Converting a vector<uint8_t> to char bytes[] can be an easier
// effort in some ways. A vector<> guarantees that all the values
// contained are 'packed' back-to-back, and contiguous in
// memory, just right for binary stream output
//
// vector.size() tells how many chars have been pushed
//
// NOTE: the formatted 'insert' operator ('<<') can not
// transfer binary data to a stream. You must use
// stream::write() for binary output.
//
std::stringstream ssOut;
// possible approach:
// 1 step reinterpret_cast
// - a binary block output requires "const char*"
const char* myBuff = reinterpret_cast<const char*>(&myBytes.front());
ssOut.write(myBuff, myBytes.size());
// block write puts binary info into stream
// confirm
std::cout << "\nConfirm6: ";
std::string s = ssOut.str(); // string with binary data
for (size_t i=0; i<s.size(); ++i)
{
// because binary data is _not_ signed data,
// we need to 'cancel' the sign bit
unsigned char ukar = static_cast<unsigned char>(s[i]);
// because formatted output would interpret some chars
// (like null, or \n), we cast to int
int intVal = static_cast<int>(ukar);
// cast does not generate code
// now the formatted 'insert' operator
// converts and displays what we want
std::cout << std::hex << std::setw(2) << std::setfill('0')
<< intVal << " ";
}
std::cout << std::endl;
//
//
return (0);
} // int t194(void)
The below snippet should be helpful!
std::ifstream input( "filePath", std::ios::binary );
std::vector<char> hex((
std::istreambuf_iterator<char>(input)),
(std::istreambuf_iterator<char>()));
std::vector<char> bytes;
for (unsigned int i = 0; i < hex.size(); i += 2) {
std::string byteString = hex.substr(i, 2);
char byte = (char) strtol(byteString.c_str(), NULL, 16);
bytes.push_back(byte);
}
char* byteArr = bytes.data()
The way I understand your question is that you want just the binary representation of the numbers, i.e. remove the ascii (or ebcdic) part. Your output array will be half the length of the input array.
Here is some crude pseudo code.
For each input char c:
if (isdigit(c)) c -= '0';
else if (isxdigit(c) c -= 'a' + 0xa; //Need to check for isupper or islower)
Then, depending on the index of c in your input array:
if (! index % 2) output[outputindex] = (c << 4) & 0xf0;
else output[outputindex++] = c & 0x0f;
Here is a function that takes a string as in your description, and outputs a string that has \x in front of each digit.
#include <iostream>
#include <algorithm>
#include <string>
std::string convertHex(const std::string& str)
{
std::string retVal;
std::string hexPrefix = "\\x";
if (!str.empty())
{
std::string::const_iterator it = str.begin();
do
{
if (std::distance(it, str.end()) == 1)
{
retVal += hexPrefix + "0";
retVal += *(it);
++it;
}
else
{
retVal += hexPrefix + std::string(it, it+2);
it += 2;
}
} while (it != str.end());
}
return retVal;
}
using namespace std;
int main()
{
cout << convertHex("01000000d08c9ddf0115d1118c7a00c04") << endl;
cout << convertHex("015d");
}
Output:
\x01\x00\x00\x00\xd0\x8c\x9d\xdf\x01\x15\xd1\x11\x8c\x7a\x00\xc0\x04
\x01\x5d
Basically it is nothing more than a do-while loop. A string is built from each pair of characters encountered. If the number of characters left is 1 (meaning that there is only one digit), a "0" is added to the front of the digit.
I think I'd use a proxy class for reading and writing the data. Unfortunately, the code for the manipulators involved is just a little on the verbose side (to put it mildly).
#include <vector>
#include <algorithm>
#include <iterator>
#include <iostream>
#include <iomanip>
#include <string>
#include <sstream>
struct byte {
unsigned char ch;
friend std::istream &operator>>(std::istream &is, byte &b) {
std::string temp;
if (is >> std::setw(2) >> std::setprecision(2) >> temp)
b.ch = std::stoi(temp, 0, 16);
return is;
}
friend std::ostream &operator<<(std::ostream &os, byte const &b) {
return os << "\\x" << std::setw(2) << std::setfill('0') << std::setprecision(2) << std::hex << (int)b.ch;
}
};
int main() {
std::istringstream input("01000000d08c9ddf115d1118c7a00c04");
std::ostringstream result;
std::istream_iterator<byte> in(input), end;
std::ostream_iterator<byte> out(result);
std::copy(in, end, out);
std::cout << result.str();
}
I do really dislike how verbose iomanipulators are, but other than that it seems pretty clean.
You can try a loop with fscanf
unsigned char b;
fscanf(pFile, "%2x", &b);
Edit:
#define MAX_LINE_SIZE 128
FILE* pFile = fopen(...);
char fromFile[MAX_LINE_SIZE] = {0};
char b = 0;
int currentIndex = 0;
while (fscanf (pFile, "%2x", &b) > 0 && i < MAX_LINE_SIZE)
fromFile[currentIndex++] = b;
I have this array : BYTE set[6] = { 0xA8,0x12,0x84,0x03,0x00,0x00, } and i need to insert this value : "" int Value = 1200; "" ....on last 4 bytes. Practically to convert from int to hex and then to write inside the array...
Is this possible ?
I already have BitConverter::GetBytes function, but that's not enough.
Thank you,
To answer original quesion: sure you can.
As soon as your sizeof(int) == 4 and sizeof(BYTE) == 1.
But I'm not sure what you mean by "converting int to hex". If you want a hex string representation, you'll be much better off just using one of standard methods of doing it.
For example, on last line I use std::hex to print numbers as hex.
Here is solution to what you've been asking for and a little more (live example: http://codepad.org/rsmzngUL):
#include <iostream>
using namespace std;
int main() {
const int value = 1200;
unsigned char set[] = { 0xA8,0x12,0x84,0x03,0x00,0x00 };
for (const unsigned char* c = set; c != set + sizeof(set); ++c) {
cout << static_cast<int>(*c) << endl;
}
cout << endl << "Putting value into array:" << endl;
*reinterpret_cast<int*>(&set[2]) = value;
for (const unsigned char* c = set; c != set + sizeof(set); ++c) {
cout << static_cast<int>(*c) << endl;
}
cout << endl << "Printing int's bytes one by one: " << endl;
for (int byteNumber = 0; byteNumber != sizeof(int); ++byteNumber) {
const unsigned char oneByte = reinterpret_cast<const unsigned char*>(&value)[byteNumber];
cout << static_cast<int>(oneByte) << endl;
}
cout << endl << "Printing value as hex: " << hex << value << std::endl;
}
UPD: From comments to your question:
1. If you need just getting separate digits out of the number in separate bytes, it's a different story.
2. Little vs Big endianness matters as well, I did not account for that in my answer.
did you mean this ?
#include <stdio.h>
#include <stdlib.h>
#define BYTE unsigned char
int main ( void )
{
BYTE set[6] = { 0xA8,0x12,0x84,0x03,0x00,0x00, } ;
sprintf ( &set[2] , "%d" , 1200 ) ;
printf ( "\n%c%c%c%c", set[2],set[3],set[4],set[5] ) ;
return 0 ;
}
output :
1200
however,thanks everyone who help me.
I want to get the VmRSS value from /proc/pid/status,below is the code
int main()
{
const int PROCESS_MEMORY_FILE_LEN = 500;
FILE *file;
std::string path("/proc/4378/status");
//path += boost::lexical_cast<std::string>( pid );
//path += "/status";
if(!(file = fopen(path.c_str(),"r")))
{
std::cout <<"open " << path<<"is failed " << std::endl;
return float(-1);
}
char fileBuffer[PROCESS_MEMORY_FILE_LEN];
memset(fileBuffer, 0, PROCESS_MEMORY_FILE_LEN);
if(fread(fileBuffer, 1, PROCESS_MEMORY_FILE_LEN - 1, file) != (PROCESS_MEMORY_FILE_LEN - 1))
{
std::cout <<"fread /proc/pid/status is failed"<< std::endl;
return float(-1);
}
fclose(file);
unsigned long long memoryUsage = 0;
int a = sscanf(fileBuffer,"VmRSS: %llu", &memoryUsage);
std::cout << a << std::endl;
std::cout << memoryUsage << std::endl;
}
at last,thanks
Based on your comments: To find VmRSS within your char array use C++ algorithms in combination with the C++ string library. Then you'll get the position of VmRSS and all you'll have to do is to retrieve the wanted result. With a little knowledge of the structure of these entries, this should be an easy task.
In addition to that it might be better to use fstream for reading directly into a string.