Hi so I'm trying to use find and replace in notepad++ with regular expression to do the following:
I have two set of lines
first set:
[c][eu][e]I37ANKCB[/e]
[c][eu][e]OIL8ZEPW[/e]
[c][eu][e]4OOEL75O[/e]
[c][eu][e]PPNW5FN4[/e]
[c][eu][e]E2BXCWUO[/e]
[c][eu][e]SD9UQNT8[/e]
[c][eu][e]E6BK6IGO[/e]
second set:
[u]7ubju2jvioks[u2]_261
[u]89j408tah1lz[u2]_262
[u]j673xnd49tq0[u2]_263
[u]dv73osmh1wzu[u2]_264
[u]twz3u4yiaeqr[u2]_265
[u]cuhtg6r71kud[u2]_266
[u]yts0ktvt9a3r[u2]_267
now I want to the second set to by places after each of the first set like this:
[c][eu][e]I37ANKCB[/e][u]7ubju2jvioks[u2]_261
[c][eu][e]OIL8ZEPW[/e][u]89j408tah1lz[u2]_262
[c][eu][e]4OOEL75O[/e][u]j673xnd49tq0[u2]_263
[c][eu][e]PPNW5FN4[/e][u]dv73osmh1wzu[u2]_264
[c][eu][e]E2BXCWUO[/e][u]twz3u4yiaeqr[u2]_265
[c][eu][e]SD9UQNT8[/e][u]cuhtg6r71kud[u2]_266
[c][eu][e]E6BK6IGO[/e][u]yts0ktvt9a3r[u2]_267
any suggestions?
You can mark the second block in column mode using ALT and the left mouse button. Then just copy paste it at the end of the first row.
No need/Not possible using regex.
I would solve this via a simple script written in Python or Ruby or something equally quick. This works, for example:
import os
path = os.path.dirname(__file__)
with open(os.path.join(path, 'file1')) as file1:
with open(os.path.join(path, 'file2')) as file2:
lines = zip(file1.readlines(), file2.readlines())
print ''.join([a.rstrip() + b for a, b in lines])
Running it gives the correct result:
> python join.py
[c][eu][e]I37ANKCB[/e][u]7ubju2jvioks[u2]_261
[c][eu][e]OIL8ZEPW[/e][u]89j408tah1lz[u2]_262
[c][eu][e]4OOEL75O[/e][u]j673xnd49tq0[u2]_263
[c][eu][e]PPNW5FN4[/e][u]dv73osmh1wzu[u2]_264
[c][eu][e]E2BXCWUO[/e][u]twz3u4yiaeqr[u2]_265
[c][eu][e]SD9UQNT8[/e][u]cuhtg6r71kud[u2]_266
[c][eu][e]E6BK6IGO[/e][u]yts0ktvt9a3r[u2]_267
Customize to suit your needs.
Related
I'm new to Python and currently learning Regular Expressions.
The code I made is:
import re
text = ('Batmobile lost a wheel. At least Batcopter is still okay.')
batRegex = re.compile(r'Bat(man|mobile|copter|bat')
mo = batRegex.findall(text)
print(mo)
When I run this, I get this:
['mobile', 'copter']
But I want to get something like:
['Batmobile', 'Batcopter']
So I re-coded according to the comment,
and changing
batRegex = re.compile(r'Bat(man|mobile|copter|bat')
to
batRegex = re.compile(r'Bat(?:man|mobile|copter|bat)')
yields the desired result of:
['Batmobile', 'Batcopter']
That solves the problem!
I have a column in data frame which ex df:
A
0 Good to 1. Good communication EI : tathagata.kar#ae.com
1 SAP ECC Project System EI: ram.vaddadi#ae.com
2 EI : ravikumar.swarna Role:SSE Minimum Skill
I have a list of of strings
ls=['tathagata.kar#ae.com','a.kar#ae.com']
Now if i want to filter out
for i in range(len(ls)):
df1=df[df['A'].str.contains(ls[i])
if len(df1.columns!=0):
print ls[i]
I get the output
tathagata.kar#ae.com
a.kar#ae.com
But I need only tathagata.kar#ae.com
How Can It be achieved?
As you can see I've tried str.contains But I need something for extact match
You could simply use ==
string_a == string_b
It should return True if the two strings are equal. But this does not solve your issue.
Edit 2: You should use len(df1.index) instead of len(df1.columns). Indeed, len(df1.columns) will give you the number of columns, and not the number of rows.
Edit 3: After reading your second post, I've understood your problem. The solution you propose could lead to some errors.
For instance, if you have:
ls=['tathagata.kar#ae.com','a.kar#ae.com', 'tathagata.kar#ae.co']
the first and the third element will match str.contains(r'(?:\s|^|Ei:|EI:|EI-)'+ls[i])
And this is an unwanted behaviour.
You could add a check on the end of the string: str.contains(r'(?:\s|^|Ei:|EI:|EI-)'+ls[i]+r'(?:\s|$)')
Like this:
for i in range(len(ls)):
df1 = df[df['A'].str.contains(r'(?:\s|^|Ei:|EI:|EI-)'+ls[i]+r'(?:\s|$)')]
if len(df1.index != 0):
print (ls[i])
(Remove parenthesis in the "print" if you use python 2.7)
Thanks for the help. But seems like I found a solution that is working as of now.
Must use str.contains(r'(?:\s|^|Ei:|EI:|EI-)'+ls[i])
This seems to solve the problem.
Although thanks to #IsaacDj for his help.
Why not just use:
df1 = df[df['A'].[str.match][1](ls[i])
It's the equivalent of regex match.
I'm trying to write a script to update a text file by replacing instances of certain characters, (i.e. 'a', 'w') with a word (i.e. 'airplane', 'worm').
If a single line of the text was something like this:
a.function(); a.CallMethod(w); E.aa(w);
I'd want it to become this:
airplane.function(); airplane.CallMethod(worm); E.aa(worm);
The difference is subtle but important, I'm only changing 'a' and 'w' where it's used as a variable, not just another character in some other word. And there's many lines like this in the file. Here's what I've done so far:
original = open('original.js', 'r')
modified = open('modified.js', 'w')
# iterate through each line of the file
for line in original:
# Search for the character 'a' when not part of a word of some sort
line = re.sub(r'\W(a)\W', 'airplane', line)
modified.write(line)
original.close()
modified.close()
I think my RE pattern is wrong, and I think i'm using the re.sub() method incorrectly as well. Any help would be greatly appreciated.
If you're concerned about the semantic meaning of the text you're changing with a regular expression, then you'd likely be better served by parsing it instead. Luckily python has two good modules to help you with parsing Python. Look at the Abstract Syntax Tree and the Parser modules. There's probably others for JavaScript if that's what you're doing; like slimit.
Future reference on Regular Expression questions, there's a lot of helpful information here:
https://stackoverflow.com/tags/regex/info
Reference - What does this regex mean?
And it took me 30 minutes from never having used this JavaScript parser in Python (replete with installation issues: please note the right ply version) to writing a basic solution given your example. You can too.
# Note: sudo pip3 install ply==3.4 && sudo pip3 install slimit
from slimit import ast
from slimit.parser import Parser
from slimit.visitors import nodevisitor
data = 'a.funktion(); a.CallMethod(w); E.aa(w);'
tree = Parser().parse(data)
for node in nodevisitor.visit(tree):
if isinstance(node, ast.Identifier):
if node.value == 'a':
node.value = 'airplaine'
elif node.value == 'w':
node.value = 'worm'
print(tree.to_ecma())
It runs to give this output:
$ python3 src/python_renames_js_test.py
airplaine.funktion();
airplaine.CallMethod(worm);
E.aa(worm);
Caveats:
function is a reserved word, I used funktion
the to_ecma method pretty prints; there is likely another way to output it closer to the original input.
line = re.sub(r'\ba\b', 'airplane', line)
should get you closer. However, note that you will also be replacing a.CallMethod("That is a house") into airplane("That is airplane house"), and open("file.txt", "a") into open("file.txt", "airplane"). Getting it right in a complex syntax environment using RegExp is hard-to-impossible.
I am trying to modify a script so that it will remove duplicate lines from a text file using only the title portion of that line.
To clarify the text file lines look something like this:
Title|Image Url|Description|Page Url
At the moment the script does remove duplicates, but it does so by reading the entire line, not just the first part. All the lines in the file are not going to be 100% the same, but a few will be very similar.
I want to remove all of the lines that contain the same "title", regardless of what the rest of the line contains.
This is the script I am working with:
import sys
from collections import OrderedDict
infile = "testfile.txt"
outfile = "outfile.txt"
inf = open(infile,"r")
lines = inf.readlines()
inf.close()
newset = list(OrderedDict.fromkeys(lines))
outf = open(outfile,"w")
lstline = len(newset)
for i in range(0,lstline):
ln = newset[i]
outf.write(ln)
outf.close()
So far I have tried using .split() to split the lines in the list. I have also tried .readline(lines[0:25]) in hopes of using a character limit to achieve the desired results, but no luck so far. I also can't seem to find any documentation on my exact problem so I'm stuck.
I am using Windows 8 and Python 2.7.9 for this project if that helps.
I made a few changes to the program you had set up. First, I changed your file interactions to use "with" statements, since those are very convenient and automatically handle a lot of the functionality you had to write out. Second off, I used a set instead of an OrderedDict because you were basically just trying to emulate set functionality (exclusivity of elements) by using keys in an OrderedDict. If the title hasn't been used, it adds it to the set so it can't be used again and prints the line to the output file. If it has been used, it keeps going. I hope this helps you!
with open("testfile.txt") as infile:
with open("outfile.txt",'w') as outfile:
titleset = set()
for line in infile:
title = line.split('|')[0]
if title not in titleset:
titleset.add(title)
outfile.write(line)
I’m trying to use a Python Regular Expression to extract a genome sequence from a genome database; I’ve pasted a snippet of the database below.
>GSVIVT01031739001 pacid=17837850 polypeptide=GSVIVT01031739001 locus=GSVIVG01031739001 ID=GSVIVT01031739001.Genoscope12X annot-version=Genoscope.12X ATGAAAACGGAACTCTTTCTAGGTCATTTCCTCTTCAAACAAGAAAGAAGTAAAAGTTGCATACCAAATATGGACTCGAT TTGGAGTCGTAGTGCCCTGTCCACAGCTTCGGACTTCCTCACTGCAATCTACTTCGCCTTCATCTTCATCGTCGCCAGGT TTTTCTTGGACAGATTCATCTATCGAAGGTTGGCCATCTGGTTATTGAGCAAGGGAGCTGTTCCATTGAAGAAAAATGAT GCTACACTGGGAAAAATTGTAAAATGTTCGGAGTCTTTGTGGAAACTAACATACTATGCAACTGTTGAAGCATTCATTCT TGCTATTTCCTACCAAGAGCCATGGTTTAGAGATTCAAAGCAGTACTTTAGAGGGTGGCCAAATCAAGAGTTGACGCTTC CCCTCAAGCTTTTCTACATGTGCCAATGTGGGTTCTACATCTACAGCATTGCTGCCCTTCTTACATGGGAAACTCGCAGG AGGGATTTCTCTGTGATGATGTCTCATCATGTAGTCACTGTTATCCTAATTGGGTACTCATACATATCAAGTTTTGTCCG GATCGGCTCAGTTGTCCTTGCCCTGCACGATGCAAGTGATGTCTTCATGGAAGCTGCAAAAGTTTTTAAATATTCTGAGA AGGAGCTTGCAGCAAGTGTGTGCTTTGGATTTTTTGCCATCTCATGGCTTGTCCTACGGTTAATATTCTTTCCCTTTTGG GTTATCAGTGCATCAAGCTATGATATGCAAAATTGCATGAATCTATCGGAGGCCTATCCCATGTTGCTATACTATGTTTT CAATACAATGCTCTTGACACTACTTGTGTTCCATATATACTGGTGGATTCTTATATGCTCAATGATTATGAGACAGCTGA AAAATAGAGGACAAGTTGGAGAAGATATAAGATCTGATTCAGAGGACGATGAATAG
>GSVIVT01031740001 pacid=17837851 polypeptide=GSVIVT01031740001 locus=GSVIVG01031740001 ID=GSVIVT01031740001.Genoscope12X annot-version=Genoscope.12X ATGGGTATTACTACTTCCCTCTCATATCTTTTATTCTTCAACATCATCCTCCCAACCTTAACGGCTTCTCCAATACTGTT TCAGGGGTTCAATTGGGAATCATCCAAAAAGCAAGGAGGGTGGTACAACTTCCTCATCAACTCCATTCCTGAACTATCTG CCTCTGGAATCACTCATGTTTGGCTTCCTCCACCCTCTCAGTCTGCTGCATCTGAAGGGTACCTGCCAGGAAGGCTTTAT GATCTCAATGCATCCCACTATGGTACCCAATATGAACTAAAAGCATTGATAAAGGCATTTCGCAGCAATGGGATCCAGTG CATAGCAGACATAGTTATAAACCACAGGACTGCTGAGAAGAAAGATTCAAGAGGAATATGGGCCATCTTTGAAGGAGGAA CCCCAGATGATCGCCTTGACTGGGGTCCATCTTTTATCTGCAGTGATGACACTCTTTTTTCTGATGGCACAGGAAATCCT GATACTGGAGCAGGCTTCGATCCTGCTCCAGACATTGATCATGTAAACCCCCGGGTCCAGCGAGAGCTATCAGATTGGAT GAATTGGTTAAAGATTGAAATAGGCTTTGCTGGATGGCGATTCGATTTTGCTAGAGGATACTCCCCAGATTTTACCAAGT TGTATATGGAAAACACTTCGCCAAACTTTGCAGTAGGGGAAATATGGAATTCTCTTTCTTATGGAAATGACAGTAAGCCA AACTACAACCAAGATGCTCATCGGCGTGAGCTTGTGGACTGGGTGAAAGCTGCTGGAGGAGCAGTGACTGCATTTGATTT TACAACCAAAGGGATACTCCAAGCTGCAGTGGAAGGGGAATTGTGGAGGCTGAAGGACTCAAATGGAGGGCCTCCAGGAA TGATTGGCTTAATGCCTGAAAATGCTGTGACTTTCATAGATAATCATGACACAGGTTCTACACAAAAAATTTGGCCATTC CCATCAGACAAAGTCATGCAGGGATATGTTTATATCCTCACTCATCCTGGGATTCCATCCATATTCTATGACCACTTCTT TGACTGGGGTCTGAAGGAGGAGATTTCTAAGCTGATCAGTATCAGGACCAGGAACGGGATCAAACCCAACAGTGTGGTGC GTATTCTGGCATCTGACCCAGATCTTTATGTAGCTGCCATAGATGAGAAAATCATTGCTAAGATTGGACCAAGGTATGAT GTTGGGAACCTTGTACCTTCAACCTTCAAACTTGCCACCTCTGGCAACAATTATGCTGTGTGGGAGAAACAGTAA
>GSVIVT01031741001 pacid=17837852 polypeptide=GSVIVT01031741001 locus=GSVIVG01031741001 ID=GSVIVT01031741001.Genoscope12X annot-version=Genoscope.12X ATGTCCAAATTAACTTATTTATTATCTCGGTACATGCCAGGAAGGCTTTATGATCTGAATGCATCCAAATATGGCACCCA AGATGAACTGAAAACACTGATAAAGGTGTTTCACAGCAAGGGGGTCCAGTGCATAGCAGACATAGTTATAAACCACAGAA CTGCAGAGAAGCAAGACGCAAGAGGAATATGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGACCCCAT CTTTCCTTTGCAAGGACGACACTCCTTATTCCGACGGCACCGGAAACCCTGATTCTGGAGATGACTACAGTGCCGCACCA GACATCGACCACATCAACCCACGGGTTCAGCAAGAGCTAA
What I’m trying to do is get the genome (ACGT) sequence for GSVIV01031740001 (the middle sequence), and none of the others. My current regex is
sequence = re.compile('(?<=>GSVIVT01031740001) pacid=.*annot-version=.*\n[ACGT\n]*[^(?<!>GSVIVT01031740001) pacid]’)
with my logic being find the header with the genbank ID for the correct organism, give me that line, then go to a new line and give me all ACGT and new lines until I get to a header for an organism with a different genbank ID. This fails to give any results.
Yes, I know that re.compile doesn’t actually perform a search; I’m searching against a file opened as ‘target’ so my execution looks like
>>> for nucl in target:
... if re.search(sequence, nucl):
... print(nucl)
Can someone tell me what I’m doing wrong, either in my regex or by using regex in the first place? When I try this on regex101.com, it works, but when I try it in the Python interpreter (2.7.1), it fails.
Thanks!
If I understand correctly , you want JUST the genomic sequence for a given locus. So You can do something like this.(assumes your data is in a file)
lines = [line.split(' ') for line in open('results.txt') ]
somedict = {}
for each in lines:
locus = each[3].split('=')[-1]
seq = ''.join(each[6:])
somedict[locus] = seq
print somedict
It outputs a dictionary with the locus as key and sequence as value
{'GSVIVG01031741001': 'ATGTCCAAATTAACTTATTTATTATCTCGGTACATGCCAGGAAGGCTTTATGATCTGAATGCATCCAAATATGGCACCCAAGATGAACTGAAAACACTGATAAAGGTGTTTCACAGCAAGGGGGTCCAGTGCATAGCAGACATAGTTATAAACCACAGAACTGCAGAGAAGCAAGACGCAAGAGGAATATGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGACCCCATCTTTCCTTTGCAAGGACGACACTCCTTATTCCGACGGCACCGGAAACCCTGATTCTGGAGATGACTACAGTGCCGCACCAGACATCGACCACATCAACCCACGGGTTCAGCAAGAGCTAA\n', 'GSVIVG01031740001': 'ATGGGTATTACTACTTCCCTCTCATATCTTTTATTCTTCAACATCATCCTCCCAACCTTAACGGCTTCTCCAATACTGTTTCAGGGGTTCAATTGGGAATCATCCAAAAAGCAAGGAGGGTGGTACAACTTCCTCATCAACTCCATTCCTGAACTATCTGCCTCTGGAATCACTCATGTTTGGCTTCCTCCACCCTCTCAGTCTGCTGCATCTGAAGGGTACCTGCCAGGAAGGCTTTATGATCTCAATGCATCCCACTATGGTACCCAATATGAACTAAAAGCATTGATAAAGGCATTTCGCAGCAATGGGATCCAGTGCATAGCAGACATAGTTATAAACCACAGGACTGCTGAGAAGAAAGATTCAAGAGGAATATGGGCCATCTTTGAAGGAGGAACCCCAGATGATCGCCTTGACTGGGGTCCATCTTTTATCTGCAGTGATGACACTCTTTTTTCTGATGGCACAGGAAATCCTGATACTGGAGCAGGCTTCGATCCTGCTCCAGACATTGATCATGTAAACCCCCGGGTCCAGCGAGAGCTATCAGATTGGATGAATTGGTTAAAGATTGAAATAGGCTTTGCTGGATGGCGATTCGATTTTGCTAGAGGATACTCCCCAGATTTTACCAAGTTGTATATGGAAAACACTTCGCCAAACTTTGCAGTAGGGGAAATATGGAATTCTCTTTCTTATGGAAATGACAGTAAGCCAAACTACAACCAAGATGCTCATCGGCGTGAGCTTGTGGACTGGGTGAAAGCTGCTGGAGGAGCAGTGACTGCATTTGATTTTACAACCAAAGGGATACTCCAAGCTGCAGTGGAAGGGGAATTGTGGAGGCTGAAGGACTCAAATGGAGGGCCTCCAGGAATGATTGGCTTAATGCCTGAAAATGCTGTGACTTTCATAGATAATCATGACACAGGTTCTACACAAAAAATTTGGCCATTCCCATCAGACAAAGTCATGCAGGGATATGTTTATATCCTCACTCATCCTGGGATTCCATCCATATTCTATGACCACTTCTTTGACTGGGGTCTGAAGGAGGAGATTTCTAAGCTGATCAGTATCAGGACCAGGAACGGGATCAAACCCAACAGTGTGGTGCGTATTCTGGCATCTGACCCAGATCTTTATGTAGCTGCCATAGATGAGAAAATCATTGCTAAGATTGGACCAAGGTATGATGTTGGGAACCTTGTACCTTCAACCTTCAAACTTGCCACCTCTGGCAACAATTATGCTGTGTGGGAGAAACAGTAA\n', 'GSVIVG01031739001': 'ATGAAAACGGAACTCTTTCTAGGTCATTTCCTCTTCAAACAAGAAAGAAGTAAAAGTTGCATACCAAATATGGACTCGATTTGGAGTCGTAGTGCCCTGTCCACAGCTTCGGACTTCCTCACTGCAATCTACTTCGCCTTCATCTTCATCGTCGCCAGGTTTTTCTTGGACAGATTCATCTATCGAAGGTTGGCCATCTGGTTATTGAGCAAGGGAGCTGTTCCATTGAAGAAAAATGATGCTACACTGGGAAAAATTGTAAAATGTTCGGAGTCTTTGTGGAAACTAACATACTATGCAACTGTTGAAGCATTCATTCTTGCTATTTCCTACCAAGAGCCATGGTTTAGAGATTCAAAGCAGTACTTTAGAGGGTGGCCAAATCAAGAGTTGACGCTTCCCCTCAAGCTTTTCTACATGTGCCAATGTGGGTTCTACATCTACAGCATTGCTGCCCTTCTTACATGGGAAACTCGCAGGAGGGATTTCTCTGTGATGATGTCTCATCATGTAGTCACTGTTATCCTAATTGGGTACTCATACATATCAAGTTTTGTCCGGATCGGCTCAGTTGTCCTTGCCCTGCACGATGCAAGTGATGTCTTCATGGAAGCTGCAAAAGTTTTTAAATATTCTGAGAAGGAGCTTGCAGCAAGTGTGTGCTTTGGATTTTTTGCCATCTCATGGCTTGTCCTACGGTTAATATTCTTTCCCTTTTGGGTTATCAGTGCATCAAGCTATGATATGCAAAATTGCATGAATCTATCGGAGGCCTATCCCATGTTGCTATACTATGTTTTCAATACAATGCTCTTGACACTACTTGTGTTCCATATATACTGGTGGATTCTTATATGCTCAATGATTATGAGACAGCTGAAAAATAGAGGACAAGTTGGAGAAGATATAAGATCTGATTCAGAGGACGATGAATAG\n'}