I am trying to manipulate a vocabulary list which is in ZDT format, that is: Traditional Characters \t Simplified Characters \t Pinyin \t English \n. I want to get rid of the Traditional Characters at the beginning of the line, so I tried to delete them with sed 's/^[^\t]*\t//g' input.txt > output.txt yet this gets me nowhere near my desired result, as in some lines everything up to somewhere in the English section is deleted and in other lines nothing at all is deleted and I cannot make out a pattern.
I think that the RegEx is correct, as I’ve tested it here and Sublime Text 2 also works with it as expected. What is the problem here?
Edit:
Beginning of input.txt http://pastebin.com/fRemVPyT
Beginning of output.txt http://pastebin.com/EJkszFNF
Not all sed version likes \t. Try to use a literal tab character. You can create a bash variable containing a tab like this:
export TAB=$'\t'
Maybe like this:
sed "s/^[^$TAB]*$TAB//g" input.txt > output.txt
Related
I have some 'fastq' format DNA sequence files (basically just text files) like this:
#Sample_1
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
#
+
#
+
#Sample_4
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
My ultimate goal is to turn these into 'fasta' format files, but to do that I need to get rid of the two empty sequences in the middle.
EDIT
The desired output would look like this:
#Sample_1
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
#Sample_4
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
+
BBBBBBBBBBBBEEEEEEEEEEEEEEEE
EHHHHKKKKKKKKKKKKKKNQQTTTTTT
All of the dedicated software I tried (Biopython, stand alone programs, perl scripts posted by others) crash at the empty sequences. This is really just a problem of searching for the string #\n+ and replacing it with nothing. I googled this and read several posts and tried about a million options with sed and couldn't figure it out. Here are some things that didn't work:
sed s/'#'/,/'+'// test.fastq > test.fasta
sed s/'#,+'// test.fastq > test.fasta
Any insights would be greatly appreciated.
PS. I've got a Mac.
Try:
sed "/^[#+]*$/d" test.fastq > test.fasta
The /d option tells sed to "delete" the matching line (i.e. not print it).
^ and $ mean "start of string" and "end of string" respectively, i.e. the line must be an exact match.
So, the above command basically says:
Print all lines that do not only contain # or +, and write the result to test.fasta.
Edit: I misunderstood the question slightly, sorry. If you want to only remove pairs of consecutive lines like
#
+
then you need to perform a multi-line search and replace.
Although this can be done with sed, it's perhaps easier to use something like a perl script instead:
perl -0pe 's/^#\n\+\n//gm' test.fastq > test.fasta
The -0 option turns Perl into "file slurp" mode, where Perl reads the entire input file in one shot (instead of line by line). This enables multi-line search and replace.
The -pe option allows you to run Perl code (pattern matching and replacement in this case) and display output from the command line.
^#\n\+\n is the pattern to match, which we are replacing with nothing (i.e. deleting).
/gm makes the substitution multiline and global.
You could also instead pass -i as the first parameter to perl, to edit the file inline.
This may not be the most elegant solution in the world, but you can use tr to replace the \n with a null character and back.
cat test.fastq | tr '\n' '\0' | sed 's/#\x0+\x0//g' | tr '\0' '\n' > test.fasta
Try this:
sed '/^#$/{N;/\n+$/d}' file
When # is found, next line is appended to the pattern space with N.
If $ is found in next line, the d command deletes both lines.
working on a large text file and I'd like to remove all lines that don't contain the text "event":"click"}]
I've tried to do some regex within Sublime 3 and can't get it to stick.
I have not used sublime but you could select all line not containing the text "event":"click"}] with the regex:
^(.(?!"event":"click"\}\]))*$
I think you could replace them by nothing(empty string) or backspace
Use this one to get result to stdout
sed -n '/"event":"click"\}\]$/p' your_large_file
Use this one to keep only lines that end with "event":"click"}], your_large_file.old backup will be generated
sed -i.old -n '/"event":"click"\}\]$/p' your_large_file
So I have a very large file that I created by combining a number of word lists. The problem is that I made the mistake of not cleaning up the original word lists before combining and sorting them, so there are a number of lines peppered throughout the file that are sentences, ASCII art, or other information that I don't want in there.
For right now, I'd like to delete any line that contains one or more spaces. I don't want to remove the spaces, I want to remove the entire line if it has a space in it.
I'm terrible with regex, and was hoping someone could help me out.
Thanks.
There is short command
sed -e '/\s/d'
It runs sed with script /\s/d which means
for each line matching /\s/ (have at least one space or tab)
run command d - delete line
So, only lines without any space will be saved.
This command will not delete empty lines.
Use it like:
sed -e '/\s/d' < input_file.txt > output_file.txt
I guess an inverted grep for spaces will do the job:
cat your_file.txt | grep -v ' ' > output.txt
It will filter the file, removing any lines with spaces.
OCR texts often have words that flow from one line to another with a hyphen at the end of the first line. (ie: the word has '-\n' inserted in it).
I would like rejoin all such split words in a text file (in a linux environment).
I believe this should be possible with sed or awk, but the syntax for these is dark magic to me! I knew a text editor in windows that did regex search/replace with newlines in the search expression, but am unaware of such in linux.
Make sure to back up ocr_file before running as this command will modify the contents of ocr_file:
perl -i~ -e 'BEGIN{$/=undef} ($f=<>) =~ s#-\s*\n\s*(\S+)#$1\n#mg; print $f' ocr_file
This answer is relevant, because I want the words joined together... not just a removal of the dash character.
cat file| perl -CS -pe's/-\n//'|fmt -w52
is the short answer, but uses fmt to reform paragraphs after the paragraphs were mangled by perl.
without fmt, you can do
#!/usr/bin/perl
use open qw(:std :utf8);
undef $/; $_=<>;
s/-\n(\w+\W+)\s*/$1\n/sg;
print;
also, if you're doing OCR, you can use this perl one-liner to convert unicode utf-8 dashes to ascii dash characters. note the -CS option to tell perl about utf-8.
# 0x2009 - 0x2015 em-dashes to ascii dash
perl -CS -pe 'tr/\x{2009}\x{2010}\x{2011}\x{2012\x{2013}\x{2014}\x{2015}/-/'
cat file | perl -p -e 's/-\n//'
If the file has windows line endings, you'll need to catch the cr-lf with something like:
cat file | perl -p -e 's/-\s\n//'
Hey this is my first answer post, here goes:
'-\n' I suspect are the line-feed characters. You can use sed to remove these. You could try the following as a test:
1) create a test file:
echo "hello this is a test -\n" > testfile
2) check the file has the expected contents:
cat testfile
3) test the sed command, this sends the edited text stream to standard out (ie your active console window) without overwriting anything:
sed 's/-\\n//g' testfile
(you should just see 'hello this is a test file' printed to the console without the '-\n')
If I build up the command:
a) First off you have the sed command itself:
sed
b) Secondly the expression and sed specific controls need to be in quotations:
sed 'sedcontrols+regex' (the text in quotations isn't what you'll actually enter, we'll fill this in as we go along)
c) Specify the file you are reading from:
sed 'sedcontrols+regex' testfile
d) To delete the string in question, sed needs to be told to substitute the unwanted characters with nothing (null,zero), so you use 's' to substitute, forward-slash, then the unwanted string (more on that in a sec), then forward-slash again, then nothing (what it's being substituted with), then forward-slash, and then the scale (as in do you want to apply the edit to a single line or more). In this case I will select 'g' which represents global, as in the whole text file. So now we have:
sed 's/regex//g' testfile
e) We need to add in the unwanted string but it gets confusing because if there is a slash in your string, it needs to be escaped out using a back-slash. So, the unwanted string
-\n ends up looking like -\\n
We can output the edited text stream to stdout as follows:
sed 's/-\\n//g' testfile
To save the results without overwriting anything (assuming testfile2 doesn't exist) we can redirect the output to a file:
sed 's/-\\n//g' testfile >testfile2
sed -z 's/-\n//' file_with_hyphens
Here's an output from less:
487451
487450<A3><BA>1<A3><BA>1
487449<A3><BA>1<A3><BA>1
487448<A3><BA>1<A3><BA>1
487447<A3><BA>1<A3><BA>1
487446<A3><BA>1<A3><BA>1
487445<A3><BA>1<A3><BA>1
484300<A3><BA>1<A3><BA>1
484299<A3><BA>1<A3><BA>1
484297<A3><BA>1<A3><BA>1
484296<A3><BA>1<A3><BA>1
484295<A3><BA>1<A3><BA>1
484294<A3><BA>1<A3><BA>1
484293<A3><BA>1<A3><BA>1
483496
483495
483494
483493
483492
483491
I see a bunch of nonprintable characters here. How do I remove them using sed/tr?
My try was 's/\([0-9][0-9]*\)/\1/g', but it doesn't work.
EDIT: Okay, let's go further down the source. The numbers are extracted from this file:
487451"><img src="Manage/pic/20100901/Adidas running-429.JPG" alt="Adidas running-429" height="120" border="0" class="BK01" onload='javascript:if(this.width>160){this.width=160}' /></a></td>
487450"><img src="Manage/pic/20100901/Adidas fs 1<A3><BA>1-060.JPG" alt="Adidas fs 1<A3><BA>1-060" height="120" border="0" class="BK01" onload='javascript:if(this.width>160){this.width=160}' /></a></td>
The first line is perfectly normal and what most of the lines are. The second is "corrupted". I'd just like to extract the number at the beginning (using 's/\([0-9][0-9]*\).*/\1/g', but somehow the nonprintables get into the regex, which should stop at ".
EDIT II: Here's a clarification: There are no brackets in the text file. These are character codes of nonprintable characters. The brackets are there because I copied the file from less. Mac's Terminal, on the other hand, uses ?? to represent such characters. I bet xterm on my Ubuntu would print that white oval with a question mark.
Classic job for either sed's or Unix's tr command.
sed 's/[^0-9]//g' $file
(Anything that is not a digit - or newline - is deleted.)
tr -cd '0-9\012' < $file > $file.1
Delete (-d) the complement (-c) of the digits and newline...
You missed the bit where you match the rest of the line.
sed 's/\([0-9][0-9]*\)[^0-9]*/\1/g'
^^^^^^^
Try this sed command:
sed 's/^\([0-9][0-9]*\).*$/\1/' file.txt
OUTPUT (running above command on the input file you provided)
487451
487450
487449
487448
487447
487446
487445
484300
484299
484297
484296
484295
484294
484293
483496
483495
483494
483493
483492
483491
If you know the crap will always be inside brackets, why not delete that crap?
sed 's/<[^>]*>//g'
EDIT: Thanks, Mike that makes sense. In that case, how about:
sed 's/([0-9]+).*/\1/g'
If the data always is like the sample, deleting from the less-than to the end of the line would work fine.
sed -i "s/<.*$//" file