Pretty new to AWK programming. I have a file1 with entries as:
15>000000513609200>000000513609200>B>I>0011>>238/PLMN/000100>File Ef141109.txt>0100-75607-16156-14 09-11-2014
15>000000513609200>000000513609200>B>I>0011>Danske Politi>238/PLMN/000200>>0100-75607-16156-14 09-11-2014
15>000050354428060>000050354428060>B>I>0011>Danske Politi>238/PLMN/000200>>4100-75607-01302-14 31-10-2014
I want to write a awk script, where if 2nd field subtracted from 3rd field is a 0, then it prints field 2. Else if the (difference > 0), then it prints all intermediate digits incremented by 1 starting from 2nd field ending at 3rd field. There will be no scenario where 3rd field is less than 2nd. So ignoring that condition.
I was doing something as:
awk 'NR > 2 { print p } { p = $0 }' file1 | awk -F">" '{if ($($3 - $2) == 0) print $2; else l = $($3 - $2); for(i=0;i<l;i++) print $2++; }'
(( Someone told me awk is close to C in terms of syntax ))
But from the output it looks to me that the String to numeric or numeric to string conversions are not taking place at right place at right time. Shouldn't it be taken care by AWK automatically ?
The OUTPUT that I get:
513609200
513609201
513609200
Which is not quiet as expected. One evident issue is its ignoring the preceding 0s.
Kindly help me modify the AWK script to get the desired result.
NOTE:
awk 'NR > 2 { print p } { p = $0 }' file1 is just to remove the 1st and last entry in my original file1. So the part that needs to be fixed is:
awk -F">" '{if ($($3 - $2) == 0) print $2; else l = $($3 - $2); for(i=0;i<l;i++) print $2++; }'
In awk, think of $ as an operator to retrieve the value of the named field number ($0 being a special case)
$1 is the value of field 1
$NF is the value of the field given in the NF variable
So, $($3 - $2) will try to get the value of the field number given by the expression ($3 - $2).
You need fewer $ signs
awk -F">" '{
if ($3 == $2)
print $2
else {
v=$2
while (v < $3)
print v++
}
}'
Normally, this will work, but your numbers are beyond awk integer bounds so you need another solution to handle them. I'm posting this to initiate other solutions and better illustrate your specifications.
$ awk -F'>' '{for(i=$2;i<=$3;i++) print i}' file
note that this will skip the rows that you say impossible to happen
A small scale example
$ cat file_0
x>1000>1000>etc
x>2000>2003>etc
x>3000>2999>etc
$ awk -F'>' '{for(i=$2;i<=$3;i++) print i}' file_0
1000
2000
2001
2002
2003
Apparently, newer versions of gawk has --bignum options for arbitrary precision integers, if you have a compatible version that may solve your problem but I don't have access to verify.
For anyone who does not have ready access to gawk with bigint support, it may be simpler to consider other options if some kind of "big integer" support is required. Since ruby has an awk-like mode of operation,
let's consider ruby here.
To get started, there are just four things to remember:
invoke ruby with the -n and -a options (-n for the awk-like loop; -a for automatic parsing of lines into fields ($F[i]));
awk's $n becomes $F[n-1];
explicit conversion of numeric strings to integers is required;
To specify the lines to be executed on the command line, use the '-e TEXT' option.
Thus a direct translation of:
awk -F'>' '{for(i=$2;i<=$3;i++) print i}' file
would be:
ruby -an -F'>' -e '($F[1].to_i .. $F[2].to_i).each {|i| puts i }' file
To guard against empty lines, the following script would be slightly better:
($F[1].to_i .. $F[2].to_i).each {|i| puts i } if $F.length > 2
This could be called as above, or if the script is in a file (say script.rb) using the incantation:
ruby -an -F'>' script.rb file
Given the OP input data, the output is:
513609200
513609200
50354428060
The left-padding can be accomplished in several ways -- see for example this SO page.
Related
I hope this is an easy fix
I originally wrote a clean and easy script that utilized gawk, I used this first and foremost because when I was solving the original issue was what I found. I now need to adapt it to only use awk.
sample file.fasta:
>gene1
>gene235
ATGCTTAGATTTACAATTCAGAAATTCCTGGTCTATTAACCCTCCTTCACTTTTCACTTTTCCCTAACCCTTCAAAATTTTATATCCAATCTTCTCACCCTCTACAATAATACATTTATTATCCTCTTACTTCAAAATTTTT
>gene335
ATGCTCCTTCTTAATCTAAACCTTCAAAATTTTCCCCCTCACATTTATCCATTATCACCTTCATTTCGGAATCCTTAACTAAATACAATCATCAACCATCTTTTAACATAACTTCTTCAAAATTTTACCAACTTACTATTGCTTCAAAATTTTTCAT
>gene406
ATGTACCACACACCCCCATCTTCCATTTTCCCTTTATTCTCCTCACCTCTACAATCCCCTTAATTCCTCTTCAAAATTTTTGGAGCCCTTAACTTTCAATAACTTCAAAATTTTTCACCATACCAATAATATCCCTCTTCAAAATTTTCCACACTCACCAAC
gawk '/[ACTG]{21,}GG/{print a; print}{a=$0}' file.fasta >"species_precrispr".fasta
what I know works is awk is the following:
awk '/[ACTG]GG/{print a; print}{a=$0}' file.fasta >"species_precrispr".fasta
the culprit therefore is the interval expression of {21,}
What I want it to do is search is for it to match each line that contains at least 21 nucleotides left of my "GG" match.
Can anyone help?
Edit:
Thanks for all the help:
There are various solutions that worked. To reply to some of the comments a more basic example of the initial output and the desired effect achieved...
Prior to awk command:
cat file1.fasta
>gene1
ATGCCTTAACTTTCAATAACTGG
>gene2
ATGGGTGCCTTAACTTTCAATAACTG
>gene3
ATGTCAAAATTTTTCATTTCAAT
>gene4
ATCCTTTTTTTTGGGTCAAAATTAAA
>gene5
ATGCCTTAACTTTCAATAACTTTTTAAAATTTTTGG
Following codes all produced the same desired output:
original code
gawk '/[ACTG]{21,}GG/{print a; print}{a=$0}' file1.fasta
slight modification that adds interval function to original awk version >3.x.x
awk --re-interval'/[ACTG]{21,}GG/{print a; print}{a=$0}' file1.fasta
Allows for modification of val and correct output , untested but should work with lower versions of awk
awk -v usr_count="21" '/gene/{id=$0;next} match($0,/.*GG/){val=substr($0,RSTART,RLENGTH-2);if(gsub(/[ACTG]/,"&",val)>= usr_count){print id ORS $0};id=""}' file1.fasta
awk --re-interval '/^>/ && seq { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS} /^>/{name=$0; seq=""; next} {seq = seq $0 } END { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS }' file1.fasta
Desired output: only grab genes names and sequences of sequences that have 21 nucleotides prior to matching GG
>gene1
ATGCCTTAACTTTCAATAACTGG
>gene5
ATGCCTTAACTTTCAATAACTTTTTAAAATTTTTGG
Lastly just to show the discarded lines
>gene2
ATG-GG-TGCCTTAACTTTCAATAACTG # only 3 nt prior to any GG combo
>gene3
ATGTCAAAATTTTTCATTTCAAT # No GG match found
>gene4
ATCCTTTTTTTTGGGTCAAAATTAAA # only 14 nt prior to any GG combo
Hope this helps others!
EDIT: As per OP comment need to print gene ids too then try following.
awk '
/gene/{
id=$0
next
}
match($0,/.*GG/){
val=substr($0,RSTART,RLENGTH-2)
if(gsub(/[ACTG]/,"&",val)>=21){
print id ORS $0
}
id=""
}
' Input_file
OR one-liner form of above solution as per OP's request:
awk '/gene/{id=$0;next} match($0,/.*GG/){val=substr($0,RSTART,RLENGTH-2);if(gsub(/[ACTG]/,"&",val)>=21){print id ORS $0};id=""}' Input_file
Could you please try following, written and tested with shown samples only.
awk '
match($0,/.*GG/){
val=substr($0,RSTART,RLENGTH-2)
if(gsub(/[ACTG]/,"&",val)>=21){
print
}
}
' Input_file
OR more generic approach where created a variable in which user could mention value which user is looking to match should be present before GG.
awk -v usr_count="21" '
match($0,/.*GG/){
val=substr($0,RSTART,RLENGTH-2)
if(gsub(/[ACTG]/,"&",val)>=usr_count){
print
}
}
' Input_file
Explanation: Adding detailed explanation for above.
awk ' ##Starting awk program from here.
match($0,/.*GG/){ ##Using Match function to match everything till GG in current line.
val=substr($0,RSTART,RLENGTH-2) ##Storing sub-string of current line from RSTART till RLENGTH-2 into variable val here.
if(gsub(/[ACTG]/,"&",val)>=21){ ##Checking condition if global substitution of ACTG(with same value) is greater or equal to 21 then do following.
print ##Printing current line then.
}
}
' Input_file ##Mentioning Input_file name here.
GNU awk accepts interval expressions in regular expressions from version 3.0 onwards. However, only from version 4.0, interval expression became defaultly enabled. If you have awk 3.x.x, you have to use the flag --re-interval to enable them.
awk --re-interval '/a{3,6}/{print}' file
There is an issue that often people overlook with FASTA files and using awk. When you have multi-line sequences, it is possible that your match is covering multiple lines. To this end you need to combine your sequences first.
The easiest way to process FASTA files with awk, is to build up a variable called name and a variable called seq. Every time you read a full sequence, you can process it. Remark that, for the best way of processing, the sequence, should be stored as a continues string, and not contain any newlines or white-spaces due. A generic awk for processing fasta, looks like this:
awk '/^>/ && seq { **process_sequence_here** }
/^>/{name=$0; seq=""; next}
{seq = seq $0 }
END { **process_sequence_here** }' file.fasta
In the presented case, your sequence processing looks like:
awk '/^>/ && seq { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS}
/^>/{name=$0; seq=""; next}
{seq = seq $0 }
END { if (match(seq,"[ACTG]{21,}GG")) print ">" name ORS seq ORS }' file.fasta
Sounds like what you want is:
awk 'match($0,/[ACTG]+GG/) && RLENGTH>22{print a; print} {a=$0}' file
but this is probably all you need given the sample input you provided:
awk 'match($0,/.*GG/) && RLENGTH>22{print a; print} {a=$0}' file
They'll both work in any awk.
Using your updated sample input:
$ awk 'match($0,/.*GG/) && RLENGTH>22{print a; print} {a=$0}' file
>gene1
ATGCCTTAACTTTCAATAACTGG
>gene5
ATGCCTTAACTTTCAATAACTTTTTAAAATTTTTGG
I am looking for a sed in which I can recognize all of the text in between two indicators and then replace it with a place holder.
For instance, the 1st indicator is a list of words
(no|noone|haven't)
and the 2nd indicator is a list of punctuation
Code:
(.|,|!)
From an input text such as
"Noone understands the plot. There is no storyline. I haven't
recommended this movie to my friends! Did you understand it?"
The desired result would be.
"Noone understands_AFFIX me_AFFIX. There is no storyline_AFFIX. I
haven't recommended_AFFIX this_AFFIX movie_AFFIX to_AFFIX my_AFFIX
friends_AFFIX! Did you understand it?"
I know that there is the following sed:
sed -n '/WORD1/,/WORD2/p' /path/to/file
which recognizes the content between two indicators. I have also found a lot of great information and resources here. However, I still cannot find a way to append the affix to each token of text that occurs between the two indicators.
I have also considered to use awk, such as
awk '{sub(/.*indic1 /,"");sub(/ indic2.*/,"");print;}' < infile
yet still, it does not allow me to append the affix.
Does anyone have a suggestion to do so, either with awk or sed?
Little more compact awk
$ awk 'BEGIN{RS=ORS=" ";s="_AFFIX"}
/[.,!]$/{f=0; $0=gensub(/(.)$/,"s\\1","g")}
f{$0=$0s}
/Noone|no|haven'\''t/{f=1}1' story
Noone understands_AFFIX the_AFFIX plot_AFFIX. There is no storyline_AFFIX. I haven't recommended_AFFIX this_AFFIX movie_AFFIX to_AFFIX my_AFFIX friends_AFFIX! Did you understand it?
Perl to the rescue!
perl -pe 's/(?:no(?:one)?|haven'\''t)\s*\K([^.,!]+)/
join " ", map "${_}_AFFIX", split " ", $1/egi
' infile > outfile
\K matches what's on its left, but excludes it from the replacement. In this case, it verifies the 1st indicator. (\K needs Perl 5.10+.)
/e evaluates the replacement part as code. In this case, the code splits $1 on whitespace, map adds _AFFIX to each of the members, and join joins them back into a string.
Here is one verbose awk command for the same:
s="Noone understands the plot. There is no storyline. I haven't recommended this movie to my friends! Did you understand it?"
awk -v IGNORECASE=1 -v kw="no|noone|haven't" -v pct='\\.|,|!' '{
a=0
for (i=2; i<=NF; i++) {
if ($(i-1) ~ "\\y" kw "\\y")
a=1
if (a && $i ~ pct "$") {
p = substr($i, length($i), 1)
$i = substr($i, 1, length($i)-1)
}
if (a)
$i=$i "_AFFIX" p
if(p) {
p=""
a=0
}
}
} 1'
Output:
Noone understands_AFFIX the_AFFIX plot_AFFIX. There is no storyline_AFFIX. I haven't recommended_AFFIX this_AFFIX movie_AFFIX to_AFFIX my_AFFIX friends_AFFIX! Did you understand it?
Given a body of text than can span a varying number of lines, I need to use a grep, sed or awk solution to search through many files for the same pattern and get the last word in the body.
A file can include formats such as these where the word I want can be named anything
call function1(input1,
input2, #comment
input3) #comment
returning randomname1,
randomname2,
success3
call function1(input1,
input2,
input3)
returning randomname3,
randomname2,
randomname3
call function1(input1,
input2,
input3)
returning anothername3,
randomname2, anothername3
I need to print out results as
success3
randomname3
anothername3
Also I need some the filename and line information about each .
I've tried
pcregrep -M 'function1.*(\s*.*){6}(\w+)$' filename.txt
which is too greedy and I still need to print out just the specific grouped value and not the whole pattern. The words function1 and returning in my sample code will always be named as this and can be hard coded within my expression.
Last word of code blocks
Split file in blocks using awk's record separator RS. A record will be defined as a block of text, records are separated by double newlines.
A record consists of fields, each two consecutive fields are separated by white space or a single newline.
Now all we have to do is print the last field for each record, resulting in following code:
awk 'BEGIN{ FS="[\n\t ]"; RS="\n\n"} { print $NF }' file
Explanation:
FS this is the field separator and is set to either a newline, a tab or a space: [\n\t ].
RS this is the record separator and is set to a doulbe newline: \n\n
print $NF this will print the field $ with index NF, which is a variable containing the number of fields. Hence this prints the last field.
Note: To capture all paragraphs the file should end in double newline, this can easily be achieved by pre processing the file using: $ echo -e '\n\n' >> file.
Alternate solution based on comments
A more elegant ans simple solution is as follows:
awk -v RS='' '{ print $NF }' file
How about the following awk solution:
awk 'NF == 0 {if(last) print last; last=""} NF > 0 {last=$NF} END {print last}' file
the $NF is getting the value of the last "word" where NF stands for number of fields. Then the last variable always stores the last word on a line and prints it if it encounters an empty line, representing the end of a paragraph.
New version with matches function1 condition.
awk 'NF == 0 {if(last && hasF) print last; last=hasF=""}
NF > 0 {last=$NF; if(/function1/)hasF=1}
END {if(hasF) print last}' filename.txt
This will produce the output you show from the input file you posted:
$ awk -v RS= '{print $NF}' file
success3
randomname3
anothername3
If you want to print FILENAME and line number like you mention then this may be what you want:
$ cat tst.awk
NF { nr=NR; last=$NF; next }
{ prt() }
END { prt() }
function prt() { if (nr) print FILENAME, nr, last; nr=0 }
$ awk -f tst.awk file
file 6 success3
file 13 randomname3
file 20 anothername3
If that doesn't do what you want, edit your question to provide clearer, more truly representative and accurate sample input and expected output.
This is the perl version of Shellfish's awk solution (plus the keywords):
perl -00 -nE '/function1/ and /returning/ and say ((split)[-1])' file
or, with one regex:
perl -00 -nE '/^(?=.*function1)(?=.*returning).*?(\S+)\s*$/s and say $1' file
But the key is the -00 option which reads the file a paragraph at a time.
I'm stil pretty new to regular expression and just started learning to use awk. What I am trying to accomplish is writing a ksh script to read-in lines from text, and and for every lines that match the following:
*RECORD 0000001 [some_serial_#]
to replace $2 (i.e. 000001) with a different number. So essentially the script read in batch record dump, and replace the record number with date+record#, and write to separate file.
So this is what I'm thinking the format should be:
awk 'match($0,"/*RECORD")!=0{$2="$DATE-n++"; print $0} match($0,"/*RECORD")==0{print $0}' $BATCH > $OUTPUT
but obviously "/*RECORD" is not going to work, and I'm not sure if changing $2 and then write the whole line is the correct way to do this. So I am in need of some serious enlightenment.
So you want your example line to look like
*RECORD $DATE-n++ [some_serial_#]
after awk's done with it?
awk '{ if (match($0, "*RECORD") != 0) { $2="$DATE-n++"; }; print }' $BATCH > $OUTPUT
Based on your update, it looks like you instead expect $DATE to be an environment variable which is used in the awk expression and n is a variable in the awk script that keeps count of how many records matched the pattern. Given that, this may look more like what you want.
$ cat script.awk
BEGIN { n=0 }
{
if (match($0, "\*RECORD") != 0) {
n++;
$2 = (ENVIRON["DATE"] "-" n);
}
print;
}
$ awk -f script.awk $BATCH > $OUTPUT
use equality.
D=$(date +%Y%m%d)
awk -vdate="$D" '
{
for(i=1;i<=NF;i++){
if ( $i == "*RECORD" ){
$(i+1) = date"00002"
break # break after searching for one record, otherwise, remove break
}
}
}1' file
i have contents in a file
like
asdfb ... 1
adfsdf ... 2
sdfdf .. 3
I want to write a unix command that should be able to add 1 + 2 + 3 and give the result as 6
From what I am aware grep and awk would be handy, any pointers would help.
I believe the following is what you're looking for. It will sum up the last field in each record for the data that is read from stdin.
awk '{ sum += $NF } END { print sum }' < file.txt
Some things to note:
With awk you don't need to declare variables, they are willed into existence by assigning values to them.
The variable NF is the number of fields in the current record. By prepending it with a $ we are treating its value as a variable. At least this is how it appears to work anyway :)
The END { } block is only once all records have been processed by the other blocks.
An awk script is all you need for that, since it has grep facilities built in as part of the language.
Let's say your actual file consists of:
asdfb zz 1
adfsdf yyy 2
sdfdf xx 3
and you want to sum the third column. You can use:
echo 'asdfb zz 1
adfsdf yyy 2
sdfdf xx 3' | awk '
BEGIN {s=0;}
{s = s + $3;}
END {print s;}'
The BEGIN clause is run before processing any lines, the END clause after processing all lines.
The other clause happens for every line but you can add more clauses to change the behavior based on all sorts of things (grep-py things).
This might not exactly be what you're looking for, but I wrote a quick Ruby script to accomplish your goal:
#!/usr/bin/env ruby
total = 0
while gets
total += $1.to_i if $_ =~ /([0-9]+)$/
end
puts total
Here's one in Perl.
$ cat foo.txt
asdfb ... 1
adfsdf ... 2
sdfdf .. 3
$ perl -a -n -E '$total += $F[2]; END { say $total }' foo
6
Golfed version:
perl -anE'END{say$n}$n+=$F[2]' foo
6