I wanted to ask if you know a reliable library to generate random graphs in C++. I have some restrictions like a maximum number of nodes and a maximum connections per node.
Construct a random set of edges (node-node pairings). You can apply restrictions by, e.g., removing a node from the set of available nodes when it reaches its quota of connections.
I have a similar interest of generating some random graphs. I found this Boost graph toolkit that can generate an Erdos-Renyi graph, which might answer part of your question, http://www.boost.org/doc/libs/1_54_0/libs/graph/doc/erdos_renyi_generator.html. I haven't tried it out yet.
Related
I am using SUMO 0.30.0 and I want to simulate an scenario with a constant number of pedestrians walking on the streets. I checked SUMO's FAQ, specifically How do I generate random routes? and I managed to maintain a constant number of vehicles using rerouters or the --max-num-vehicles option in the sumo.cfg file. However, rerouters are not yet implemented for persons in SUMO.
Is there any way of maintain a fixed number of pedestrians?
I want to use this scenario with Veins and OMNeT++, so maybe there's a way of maintaint the number of pedestrians using Veins (?)
I’m currently reading “Mastering Bitcoin” and am wondering if all mining nodes in the network solve the same cryptographic puzzle(ie target in the block headers). If so, how do they get that target? Is it distributed by gossip or predetermined by the bitcoin code?
I understand that every now and then they reset the target to adjust to the computing power. If it’s determined by a formula, wouldn’t there be a potential for different mining nodes having different targets because of temporary forks?
Now, let’s say we allow them to have different targets. How do different nodes validate that the mining node didn’t make up an arbitrarily easy target so it can set next block?
Nodes calculate the target based on the previous two weeks average block time. If the average block time is less than 10 min, it will raise the target, and vice-versa. Since they all use the same algorithm, there’s no need to gossip this value.
The nodes are programmed by default to accept the chain of blocks with the most total work. A solved block with a high difficulty represents a lot of work. If a miner tries to mine a block with a low difficulty, other nodes will reject that block when it is submitted and continue mining.
Let me know if that doesn’t make sense!
I now use apriori algorithm to do a data mining project,and I get result such as:item1 <=> iteam2、item2 <=> item3.......
I want use graph mining to generate a graph containing many nodes and illustrating relation between these node like this：
I heard some data ming software--weka,rapidminer;I also heard some graph library--igraph,networkx;I also heard--tableau.But I'm still confused,could someone give me a illustration about detailed procedure?
I recommend using Prefuse tool kit for your problem. Take a look here http://prefuse.org/gallery/ . This contains an example of the graph that you need.
Loosely speaking, Prefuse also has a browser version called D3.js . If you want to display your graph in browser then use D3.js
I have used Prefuse as well as D3.js when I needed a desktop graph and a graph in the browser.
If by multi-node graph you are referring to this definition http://dl.acm.org/citation.cfm?id=1292799, then I would say that you could use Gephi to visualize your graph. Gephi is a powerful tool for network visualization/analysis, since you can annotate the vertices, apply clustering algorithms etc.
In your case, since multi-node graphs have multiple states, you can either use some annotation/coloring to show the different states of the nodes/edges, or even visualize these different states by importing different timestamps/versions of the network in Gephi. You can then observe the differences among them. Even if your graph is not multi-node, I would recommend Gephi for visualizing it.
If item1 <=> iteam2、item2 <=> item3 .. is your current data format, you can transform it to a format that Gephi recognizes, like adjacency list or edge list.
I'm very new in image processing and my first assignment is to make a working program which can recognize faces and their names.
Until now, I successfully make a project to detect, crop the detected image, make it to sobel and translate it to array of float.
But, I'm very confused how to implement the Backpropagation MLP to learn the image so it can recognize the correct name for the detected face.
It's a great honor for all experts in stackoverflow to give me some examples how to implement the Image array to be learned with the backpropagation.
It is standard machine learning algorithm. You have a number of arrays of floats (instances in ML or observations in statistics terms) and corresponding names (labels, class tags), one per array. This is enough for use in most ML algorithms. Specifically in ANN, elements of your array (i.e. features) are inputs of the network and labels (names) are its outputs.
If you are looking for theoretical description of backpropagation, take a look at Stanford's ml-class lectures (ANN section). If you need ready implementation, read this question.
You haven't specified what are elements of your arrays. If you use just pixels of original image, this should work, but not very well. If you need production level system (though still with the use of ANN), try to extract more high level features (e.g. Haar-like features, that OpenCV uses itself).
Have you tried writing your feature vectors to an arff file and to feed them to weka, just to see if your approach might work at all?
Weka has a lot of classifiers integrated, including MLP.
As I understood so far, I suspect the features and the classifier you have chosen not to work.
To your original question: Have you made any attempts to implement a neural network on your own? If so, where you got stuck? Note, that this is not the place to request a complete working implementation from the audience.
To provide a general answer on a general question:
Usually you have nodes in an MLP. Specifically input nodes, output nodes, and hidden nodes. These nodes are strictly organized in layers. The input layer at the bottom, the output layer on the top, hidden layers in between. The nodes are connected in a simple feed-forward fashion (output connections are allowed to the next higher layer only).
Then you go and connect each of your float to a single input node and feed the feature vectors to your network. For your backpropagation you need to supply an error signal that you specify for the output nodes. So if you have n names to distinguish, you may use n output nodes (i.e. one for each name). Make them for example return 1 in case of a match and 0 else. You could very well use one output node and let it return n different values for the names. Probably it would even be best to use n completely different perceptrons, i.e. one for each name, to avoid some side-effects (catastrophic interference).
Note, that the output of each node is a number, not a name. Therefore you need to use some sort of thresholds, to get a number-name relation.
Also note, that you need a lot of training data to train a large network (i.e. to obey the curse of dimensionality). It would be interesting to know the size of your float array.
Indeed, for a complex decision you may need a larger number of hidden nodes or even hidden layers.
Further note, that you may need to do a lot of evaluation (i.e. cross validation) to find the optimal configuration (number of layers, number of nodes per layer), or to find even any working configuration.
Good luck, any way!
I'm working on a tool to visualize RNA secondary structure, for this purpose I have implemented Nussinov's algorithm which generates the RNA secondary structure as list with the corresponding indices, the code can be found here [0]
[0] http://dpaste.com/596262/
But I really stuck with understanding how I should visualize it (as a planar graph), the code above gives me a sequential list of the secondary structure, so can someone please suggest me as to how I can visualize the structure.An example of such tool can be found here [1]
[1] http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi
and I know there are better algorithms but for now I would just want to visualize with this and once I understand visualization, I will go for a better algorithm.
Visualizing the secondary structure of RNA (or any graph, for that matter) algorithmically is a difficult problem. You need to take care that there are as few overlaps as possible while maintaining consistent link lengths. As the other answers have pointed out, there are a number of existing implementations that you can already use. I'll just throw in another one that's quite easy to use and requires no downloads:
forna - nibiru.tbi.univie.ac.at/forna
Here you just need to enter a dotbracket string:
>molecule_name
CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
((((((((((..((((((.........))))))......).((((((.......))))))..)))))))))
This will give you a visualization that looks something like this:
This is computed using a combination of the ViennaRNA RNAplot program and d3's force-directed graph algorithm.
You could do this with jmol . Jmol allows you to add arbitrary bonds / atoms to a coordinate space using its java or I believe its javascript api also.
In general, of course, PDB file formats would be used for such data.
RNAviz is old but still commonly used. JalView apparently was supposed to get RNA secondary structure rendering thru a GSoC project last year, but I'm not sure what the status in the program is.